We want to
hear from you!
Tip:
1. To search the note, press CTRL-F keys in combination Click here
2. To navigate the note, use the links.
GeneRacerâ„? Kit
TABLE OF CONTENTS
PRODUCT DESCRIPTION
Applications
SHIPPING CONDITIONS
STORAGE CONDITIONS
STABILITY
QC SPECIFICATIONS
PROTOCOL & APPLICATION NOTES
Designing Gene-Specific Primers
RNA Precipitation Step
Troubleshooting/General Questions
Other Notes
COMPETITOR INFORMATION
ALTERNATE PRODUCTS & COMPATIBILITY
PRODUCT DOCUMENTATION
REFERENCES
PRODUCT NAME & CATALOG NUMBER
COMPONENTS
ASSOCIATED PRODUCTS
RELATED TECHNICAL SUPPORT NOTES
PRODUCT DESCRIPTION
(back to Table of Content)
The GeneRacer� Kit provides a method to obtain full-length 5� and 3� ends of cDNA using known cDNA sequence from
expressed sequence tags (ESTs), subtracted cDNA, differential display, or library screening. The kit ensures the amplification
of only full-length transcripts via elimination of truncated messages from the amplification process. RACE PCR products can
be quickly and easily cloned using either the Zero Blunt® TOPO® PCR Cloning Kit for Sequencing (blunt-end PCR products)
or the TOPO TA Cloning® for Sequencing Kit (PCR products with 3� A-overhangs).
Using the protocol provided, the cDNA ends of rare (30 copies/cell) and long (10 kb - ) transcripts can be amplified and
sequenced starting from 1 µg of total RNA.
Applications
(back to Table of Content)
(back to Protocol and Application Notes)
The GeneRacerâ„? Kit can be used to:
Identify the 5� and 3� untranslated regions of genes
Study heterogeneous transcriptional start sites
Obtain the complete cDNA sequence of a gene.
SHIPPING CONDITIONS
(back to Table of Content)
Each GeneRacerâ„? Kit is shipped on dry ice, overnight delivery. Upon receipt, store the components of the
kit as listed below.
STORAGE CONDITIONS
(back to Table of Content)
GeneRacer� Core Module (450168) Store at -20°C (Primers are stable for six months).
SuperScript™III RT Module (450167) Store at -20°C
AMV RT Module (450166) Store at -80°C
S.N.A.P. â„? Columns (460261) Store at Room Temperature
TOPO TA Cloning® Kit for Sequencing (450071) Store at -20°C
Zero Blunt® TOPO® PCR Cloning Kit for Sequencing (450159) Store at -20°C
One Shot® TOP10 Chemically Competent E.coli (440012) Store at -80°C
STABILITY
(back to Table of Content)
Each GeneRacerâ„? Kit is guaranteed for 6 months when properly stored.
QC SPECIFICATIONS
(back to Table of Content)
Functional QC: Invitrogen functionally qualifies the GeneRacerâ„? Kit using the control HeLa total RNA, the reagents in
the kit, and the protocol described in this manual. The resulting RACE-ready cDNA is analyzed for the 5� and 3� ends of
the B-actin gene using the GeneRacerâ„? primers and Control primers included in the kit. Fifteen microliters of the PCR
(50 µl) is analyzed on a 1.2% E-Gel. The table below summarizes the primers used for amplification and the expected
results. No products are visible when the cDNA template is subjected to PCR with only one of the primers, or when both
primers are included and the cDNA template omitted.
Forward Primer Reverse Primer Size of Product
GeneRacer� 5� Control Primer B.1 ~900 bp
Control Primer A Control Primer B.1 ~750 bp
Control Primer A ~1800 kb
GeneRacer 3�
RNase Activity: Visualization of control RNA on a gel following TAP treatment must show no degradation when
compared to unmodified RNA.
PROTOCOL AND APPLICATION NOTES
(back to Table of Content)
Designing Gene-Specific Primers
RNA Precipitation Step
Troubleshooting/General Questions
Other Notes
Designing Gene-Specific Primers
(back to Table of Content)
(back to Protocol and Application Notes)
For detailed protocols, please see the manual on the web site:
You may use either 1-5 µg total RNA or 50-250 ng mRNA with the GeneRacer� Kit.
You will need at least one GSP if you are performing either 5� or 3� RACE. You will need at least two GSPs if you are doing
both 5� and 3� RACE. Gene-specific primers should have the following characteristics:
50-70% GC content to obtain a high annealing temperature (>70°C). Using primers with a high annealing temperature
will improve the specificity of your PCR.
23-28 nucleotides long to increase specificity of binding.
Low GC content at 3� ends to minimize extension by DNA polymerase at non-target sites (no more than two G or C
residues in the last five bases).The purpose of the low GC content is to weaken the annealing of the 3' end in order to
reduce extension of non-specifically bound primer. If the primer binds specifically then the strong annealing of the rest
of the primer is sufficient to ensure preferential extension by polymerase even though the 3' end is not GC rich. In
RACE, it is specially important to minimize non-specific amplification because the PCR is done with just one gene
specific primer while the other primer is common to all messages.
No self-complementary sequences within the primer or no sequence complementary to the primers supplied in the kit
especially at the 3� end.
Annealing temperature greater than 70°C to facilitate touchdown PCR (see below for annealing temperature calculation).
Touchdown PCR and high annealing temperatures increase primer binding specificity and reduce non-specific
amplification. For best results, design primers as close to the cDNA ends as possible to minimize the size of the RACE
PCR product.
RNA Precipitation Step
(back to Table of Content)
(back to Protocol and Application Notes)
In the GeneRacerâ„? protocol, is the 10 minute dry ice RNA precipitation step sufficient for optimal recovery of sample or
does the optional overnight, -20°C step increase the yield?
Dry ice precipitation: 10 min on dry ice should provide optimal recovery. There is no need to do it overnight. We offer the
suggestion of leaving the reaction overnight as a convenient stopping point for those who wish to continue at a later time. We
Quality Control test the kit using the 10 minute incubation.
Troubleshooting/General Questions
(back to Table of Content)
(back to Protocol and Application Notes)
Please also see the manual.
No RACE PCR Products:
First check HeLa control RNA
1 µg of HeLa total RNA is supplied with the kit. This is enough to do one control reaction.
The troubleshooting should first be with the PCR reaction, rather than with cDNA generation. Use the cDNA generated
from the HeLa control experiment to troubleshoot the PCR. If no bands are observed with the control primers, try PCR
again, adjusting annealing temperature and extension time, and possibly the number of cycles to optimize your
Polymerase and PCR machine. Alternatively, use Platinum Taq High Fidelity and Accuprime Pfx as recommended in
their respective Manuals.
HeLa control RNA is not DNase treated. If you successfully amplified control B-actin RACE products from control
HeLa RNA, but did not obtain any RACE PCR products from your gene of interest, use the suggested causes and
solutions below
Your gene is in low abundance
Increase the number of PCR cycles. Perform nested PCR
Your gene is not expressed in this tissue
Amplify with two GSPs to assay for the presence of your gene’s cDNA.
RT reaction failed to generate cDNA for your gene
Perform RT with Random Primers or a GSP that hybridizes as close as possible to the 5� end. You can also
combine the Random Primers with the GeneRacerâ„? Oligo dT Primer to increase the chances of obtaining full-
length cDNA.
The cDNA template is a difficult template for PCR
Optimize PCR parameters or reaction buffer. Lower the annealing temperature. Use 5-10% DMSO in the PCR
to help read through GC-rich regions. Use a high-processivity, high-fidelity PCR enzyme.
No Bands observed after PCR
Standard PCR troublehooting applies. If no PCR bands are obtained, one can lower the annealing temperature (2-
5°C), and/or put the reaction tube back in for more cycles (<10). If multiple bands are seen, one can raise the
annealing temperature and decrease the number of cycles. Control Primer B.1 can also be used for a second round of
PCR to increase specificity.
mRNA Quality and Stability:
The key factor for RACE success is quality of the RNA. RNA degradation is the most likely reason for failure to obtain
a correct RACE product. We strongly recommend that you analyze a sample of your RNA on an agarose gel
before starting.
The presence of RNaseOUTâ„? RNase inhibitor ensures RNA stability during various enzymatic reactions. If you are
concerned about RNA stability, you may check the stability of the RNA after each enzymatic reaction (CIP, TAP and
ligation reaction) using agarose gel electrophoresis. Resuspend the RNA in DEPC water after enzymatic treatment in
an appropriate volume and run about 100-200 ng or 1 µl on an agarose gel. Compare with the same amount of
untreated RNA to check for degradation.
RT Reaction Optimization:
Use half of the ligation reaction in the RT reaction in case you have to repeat the RT reaction
You can use the B-actin control primers A and B.1 to confirm the presence of cDNA in your sample.
Use the following conditions
94°C for 2 minutes;
94°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, repeat for 25 cycles
72°C for 7 minutes
If the primers successfully amplify the 748 bp fragment of beta-actin gene, then the RT reaction worked and you
need to examine the CIP, TAP, and ligation procedures to ensure that you performed each step correctly. Repeat the
reactions with fresh RNA and check for RNA stability after each enzymatic step as described above in mRNA
Quality and Stability.
If the primers do not amplify the B-actin gene, then either the RNA was degraded or the RT reaction failed. You
need to start over with fresh RNA. Perform a control RT reaction using the control HeLa total RNA to ensure that
your RT reaction is working.
Inactivate RT prior to PCR by heating the first strand cDNA. RT inactivation helps amplify larger targets.
RACE PCR Artifacts:
RACE PCR artifacts or non-specific PCR bands can result from one or more of the following.
Non-specific binding of GSPs to other cDNAs resulting in the amplification of unrelated products as well as desired
products.
Non-specific binding of GeneRacerâ„? primers to cDNA resulting in PCR products with GeneRacerâ„? primer
sequence on both ends of the PCR product.
RNA degradation
Contamination of PCR tubes or reagents
Note: Artifacts usually result from less than optimal PCR conditions and can be identified in negative control PCR.
Not-Full-Length 5� RACE PCR Products:
The GeneRacerâ„? method is designed to ensure that only full-length messages are ligated to the GeneRacerâ„? RNA Oligo
and PCR amplified after cDNA synthesis. It is highly recommended that you clone your RACE products and analyze at
least 10-12 colonies. to ensure that you isolate the longest message. Many genes do not have the only one set
transcription start site but rather multiple transcription start sites spanning sometimes just a few or other times a hundred
or even more bases. Cloning of the RACE products and analyzing multiple colonies ensues that you detect the diversity
of the heterogeneous transcription start sites of your gene. It is also possible that you might obtain PCR products that
represent not-full-length message for your gene. PCR products that do not represent full-length message may be obtained
because:
RNA degradation after the CIP reaction creates new truncated substrates with a 5� phosphate for ligation to the
GeneRacerâ„? RNA Oligo. Be sure to take precautions to ensure that the RNA is not degraded.
CIP dephosphorylation was incomplete. Increase the amount of CIP in the reaction or decrease the amount of RNA.
PCR yielded a PCR artifact and not true ligation product. Optimize your PCR using the suggestions described above
Customer sees smears when he performed negative control using 5� primer. The other negative controls (no template, GSP
with template) were fine. All reactions had the same PCR conditions:
If there is background when using the 5' primer and template than researcher should subtract those bands/smear from the
actual RACE reaction discarding it so that not to confuse with the real RACE bands. The smear in that negative control
will always be there because every cDNA has the binding site for that primer. So there should not be any major concern
about the smear. If the actual RACE PCR works than the RACE band would outweigh the smear background.
Modification of the RNA oligo � can a restriction site at the 3´ end (rare cutter, long palindrome sequence) be inserted in this
oligo?
The sequence of the RNA oligo is designed without the restriction sites because the PCR amplified RACE products are
more efficiently cloned by TA or TOPO/TA cloning vectors than by the restriction digest and ligation. We have not
tested any restriction site sequences in the RNA oligo for that reason.
Other notes:
(back to Table of Content)
(back to Protocol and Application Notes)
GeneRacerâ„? Primer Layout
GeneRacer � 5� nested primer
5�-GGACACUGACAUGGACUGAAGGAGUA-3�
GeneRacer� 5� primer
5�-CGACUGGAGCACGAGGACACUGA-3�
GeneRacerâ„? RNA oligo
5�-CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA
GeneRacerâ„? oligo- dT primer
3�--TTTT(T)20-GTGACAGTACGGCAATGCATCGCATAGCAACTGTCG-5�
GeneRacer� 3� primer
3�-GCAATGCATCGCATAGCAACTGTCG-5�
GeneRacer� 3� nested primer
3�-GTGACAGTACGGCAATGCATCGC-5�
RNA oligo
Design:
The 44-mer RNA Oligo is synthesized and PAGE purified. It is not phosphorylated, so it cannot form concatamers. The
RNA Oligo was rigorously optimized in R&D. It was designed to have minimal secondary structure and have adenines at
the 3'-end. The presence of adenines as opposed to uridines at the 3' end aids in the ligation efficiency. The sequence was
also checked against GenBank to eliminate or minimize homology to human cDNA sequence.
QC:
The RNA oligo size is checked by agarose gel analysis. It is verified to contain the 5' GeneRacerâ„? and 5' Nested
GeneRacerâ„? sequences during the functional QC
Other issues:
Liquid in lyophilized RNA oligo: The GeneRacerâ„? RNA oligo is lyophilized to ensure stability. Any liquid in the tubes
might be left over from the lyophilization process. However, this should not adversely effect the ligation of the RNA
oligo to the mRNA. If there is liquid in the tubes, it is possible to increase the reaction volume to 15 µl and adjust the
10x buffer to make the final concentration 1X. Alternatively, resuspend the decapped RNA in lesser volume prior to
adding it to the RNA oligo tube.
Phenol: Chloroform
There is enough Phenol:Chloroform supplied in the GeneRacerâ„? kit to complete 5 reactions and the HeLa RNA control. The
kit is supplied with 2 X 1ml aliquots of Phenol:Chloroform. Each reaction requires 200 µl.
Calf Intestinal Phosphatase (CIP)
The CIP enzyme does NOT recognize triphosphates nucleotides. If the ends of the product have anything other than a
monophosphate, the CIP will not dephosphorylate it. This means that later in the protocol, the ligase will not ligate the
RNA oligo to this 5' triphosphate. Therefore, if one follows the protocol provided for obtaining full length capped
messages, one will not get any product at all from this original 5' triphosphate-RNA material.
We do not recommend replacing the CIP with shrimp alkaline phosphatase (SAP) in order to eliminate the phenol/chloroform
step and allow for heat inactivation.
PRODUCT DOCUMENTATION
(back to Table of Content)
Brochures Citations Cell lines
COA FAQ Licensing
Manuals MSDS Newsletters
Tools & Tips Vector Data
PRODUCT NAME AND CATALOG NUMBERS
(back to Table of Content)
Catalog Product Name
No.
GeneRacer� with SuperScript � III RT and TOPO TA Cloning® Kit for Sequencing
L1502-01
GeneRacer� with SuperScript � III RT and Zero Blunt® TOPO® PCR Cloning Kit for Sequencing
L1502-02
GeneRacer� with Cloned AMV RT and TOPO TA Cloning® Kit for Sequencing
L1500-01
GeneRacer� with Cloned AMV RT and Zero Blunt® TOPO® PCR Cloning Kit for Sequencing
L1500-02
COMPONENTS
(back to Table of Content)
Note: distinguishing features of each kit are shown in bold
L150201(L1502-01) GeneRacer� with SuperScript � III RT and TOPO TA Cloning® Kit for Sequencing
25-0276 TOPO® TA Sequencing manual 250355 GeneRacer� Manual
®
450071 TOPO® TA for Seq 10 rxn
44-0012 One Shot TOP10 10 rxn
â„? â„?
450168 GeneRacerâ„? Core Kit
45-0167 GeneRacer SuperScript Module
46-0261 SNAP Columns (10)
L150202 (L1502-02) GeneRacer� with SuperScript � III RT and Zero Blunt® TOPO® PCR Cloning Kit for
Sequencing
250277 TOPO® Blunt Sequencing manual 250355 GeneRacer� Manual
®
450159 Zero Blunt® for Sequencing 10rxn
440012 One Shot TOP10 10 rxn
â„? â„?
450168 GeneRacerâ„? Core Kit
450167 GeneRacer SuperScript Module
460261 SNAP Columns (10)
L150001(L1500-01) GeneRacerâ„? with AMV RT AND TOPO TA Cloning Kit for Sequencing
250276 TOPO® TA Sequencing manual 250355 GeneRacer� Manual
®
450071 TOPO® TA for Seq 10 rxn
440012 One Shot TOP10 10 rxn
â„?
450168 GeneRacerâ„? Core Kit
450166 GeneRacer AMV-RT module
460261 SNAP Columns (10)
L150002 (L1500-02) GeneRacerâ„? with AMV RT AND Zero Blunt TOPO PCR Cloning Kit for Sequencing
250277 TOPO® Blunt Sequencing Manual 250355 GeneRacer� Manual
®
451519 Zero Blunt® for Sequencing 10 rxn
440012 One Shot TOP10 10 rxn
â„?
450168 GeneRacerâ„? Core Kit
450166 GeneRacer AMV-RT module
460261 SNAP Columns (10)
GeneRacerâ„? Module.
This is comprised of two sub-components:
Core Module (450168)
Either the Superscriptâ„? III RT module (450167) or AMV RT module (450166)
The GeneRacerâ„? kit contains reagents for the following:
Five PCR-ready cDNA synthesis reactions
One control cDNA reaction
Primers for 50 PCRs on either the 5� or 3� end.
Reagents are included for dephosphorylating (CIP) RNA, removing (TAP) the mRNA cap structure, ligating the
GeneRacerâ„? RNA Oligo to the mRNA, reverse transcribing the mRNA, purifying the PCR reaction with SNAP columns
and cloning into a TOPO® vector followed by transformation into TOP10 E.coli.
The user must supply additional PCR reagents such as a DNA Polymerase (i.e. Taq or alternative high fidelity DNA
polymerase).
GeneRacerâ„? Core Module - Part # 450168:
Component Formulation Amount
Sterile Water Sterile, diethylpyrocarbonate (DEPC)- 2 x 1.5 ml
treated (“DEPC water�)
24 µl
RNaseOUT� 40 U/µl in:
20 mM Tris-HCl, pH 8
50 mM KCl
0.5 mM EDTA
8 mM DTT
50% glycerol (v/v)
6 µl
Calf Intestinal Phosphatase 10 U/µl in:
(CIP) 25 mM Tris-HCl, pH 7.6 (+4°C)
1 mM MgCl2
0.1 mM ZnCl2
50% glycerol (w/v)
6 µl
10X CIP Buffer 0.5 M Tris-HCl, pH 8.5 (20°C)
1 mM EDTA
6 µl
Tobacco Acid Pyrophosphatase 0.5 U/µl in:
(TAP) 10 mM Tris-HCl, pH 7.5
0.1 M NaCl
0.1 mM EDTA
1 mM DTT
0.01% Triton® X-100
50% glycerol (w/v)
6 µl
10X TAP Buffer 0.5 M sodium acetate, pH 6.0
10 mM EDTA
1% -mercaptoethanol
0.1% Triton® X-100
GeneRacerâ„? RNA Oligo Pre-aliquoted, lyophilized 6 x 250 ng
6 µl
T4 RNA Ligase 5 U/µl in:
50 mM Tris-HCl, pH 7.5
0.1 M NaCl
0.1 mM EDTA
1 mM DTT
0.1% Triton® X-100
50% glycerol (w/v)
6 µl
10X T4 RNA Ligase Buffer 330 mM Tris-Acetate, pH 7.8 (25°C)
660 mM potassium acetate
100 mM magnesium acetate
5 mM DTT
6 µl
10 mM ATP Nuclease-free water and neutralized to
pH 7 with NaOH
Phenol/Chloroform Phenol:chloroform:isoamyl alcohol 2 x 1 ml
(25:24:1)
0.1% 8-Hydroxyquinoline
36 µl
Mussel Glycogen 10 mg/ml in DEPC water
200 µl
3 M Sodium Acetate in DEPC water, pH 5.2
10 µM in DEPC water (71.5 ng/µl) 225 µl
GeneRacer� 5� Primer
10 µM in DEPC water (81.3 ng/µl) 225 µl
GeneRacer� 5� Nested Primer
10 µM in DEPC water (76.9 ng/µl) 225 µl
GeneRacer� 3� Primer
10 µM in DEPC water (71.1 ng/µl) 225 µl
GeneRacer� 3� Nested Primer
20 µl
Control HeLa Total RNA 500 ng/µl in DEPC water
10 µM in DEPC water (73.9 ng/µl) 15 µl
Control Primer A
10 µM in DEPC water (67.1 ng/µl) 15 µl
Control Primer B.1
SUPERSCRIPTâ„? III RT Module - Part #450167 (one of two options for GeneRacerâ„? Core Module):
Component Formulation Amount
6 µl
SuperScript � III Reverse 200 U/µl in:
Transcriptase (RT) 20 mM Tris-HCl, pH 7.5
100 mM NaCl
0.1 mM EDTA
1 mM DTT
0.01% Nonidet P-40 (v/v)
50% glycerol (w/v)
24 µl
5X First Strand Buffer 250 mM Tris-HCl, pH 8.3
375 mM KCl
15 mM MgCl2
15 µl
0.1 M DTT in DEPC water
6 µl
RNase H 2 U/µl in:
20 mM Tris-HCl, pH 7.5
100 mM KCl
10 mM MgCl2
0.1 mM EDTA
0.1 mM DTT
50 µg/ml BSA
50% glycerol
100 ng/µl in DEPC water (54 µM) 6 µl
Random Primers (N6)
900 ng/µl in DEPC water (50 µM) 6 µl
GeneRacerâ„? Oligo dT Primer
6 µl
dNTP Mix 10 mM dATP
(10 mM each) 10 mM dGTP
10 mM dCTP
10 mM dTTP
in 1 mM Tris-HCl, pH 7.5
AMV RT Module - Part #450166 (one of two options for Gene Racer Core Module):
Component Part # Amount Formulation
460242 6 µl
Avian Myeloblastosis 5 U/µl in: 200 mM potassium phosphate, pH 7.2; 2 mM DTT;
Virus Reverse 0.2% Triton X-100; 50% glycerol (w/v)
Transcriptase;
aka (AMV-RT)
460238 12 µl
10X RT Buffer 250 mM Tris-HCl, pH 8.3 (25°C); 50 mM MgCl2; 500 mM KCl;
20 mM DTT
460240 6 µl 100 ng/µl in DEPC water (54 µM)
Random Primers (N6)
460241 6 µl 820 ng/µl in DEPC water (50 µM) Sequence:
GeneRacer Oligo dT
Primer (60 bases) GCTGTCAACGATACGCTACGTAACGGCATGACAGTG
(T)24
460369 6 µl
100 mM dNTPs 25 mM dATP; 25 mM dGTP; 25 mM dCTP; 25 mM dTTP; in
200 mM Tris-HCl, pH 7.5
S.N.A.P. Columns (460261) Ten S.N.A.P. columns are provided in the kit to gel-purify your PCR products prior to
cloning. Store at room temperature.
Depending on which GeneRacerâ„? system is ordered, the customer will receive one of the following Vector kits:
TOPO TA Cloning® Kit for Sequencing (450071):
Contains cloning reagents and One Shot® TOP10 Chemically Competent E. coli to clone the GeneRacer� PCR product
with 3�-A overhangs for sequencing. The kit contains sufficient reagents to clone 10 GeneRacer� PCR products. Follow
the protocol in the manual for the TOPO TA Cloning® kit.
Zero Blunt® TOPO® PCR Cloning Kit for Sequencing (450159): Contains cloning reagents and One Shot® TOP10
Chemically Competent E. coli to clone the GeneRacerâ„? blunt-end PCR product for sequencing. The kit contains
sufficient reagents to clone 10 GeneRacer� PCR products. Follow the protocol in the manual for the Zero Blunt® kit.
One Shot® TOP10 Chemically Competent E.coli (440012)
Need more help? Please email us by clicking here.
|