We want to
hear from you!
Tip:
1. To search the note, press CTRL-F keys in combination Click here
2. To navigate the note, use the links.
Mammalian Expression Vectors
TABLE OF CONTENTS
PRODUCT DESCRIPTION
Vectors-General description
Promoters
Fusion Tags
Selection Markers
Nomenclature of vectors
SHIPPING CONDITIONS
STORAGE CONDITIONS
STABILITY
QC SPECIFICATIONS
PROTOCOL & APPLICATION NOTES
General information
Common vector elements
Elements important for efficient eukaryotic translation
Kozak sequence
Promoters
CMV promoter
SV40 promoter
EF-1α promoter
Ubc promoter
PGK promoter
Promoter strength comparison
Polyadenylation and Transcription termination
Origin of Replication: pUC ori and pBR322 ori
Untranslated regions (UTRs)
Enhancers
Antibiotic Selection Markers for Eukaryotic Selection and for Cloning in Bacteria
Expression yields of specific proteins
Molecular weights of Epitope tags and Control proteins
Vector specific information
pCDM8
pcDNA1, pcDNA1.1, pcDNA1/Amp, pcDNA1.1/Amp and pcDNA1/Neo
pcDNA3 and pcDNA3.1 Difference between pcDNA3 and pcDNA3.1
pCDNA3.2 and pCDNA6.2
pDEST26
pDEST27
pCR3.1 pCDNA3.1 His
pCDNA3.1 myc-His
pcDNA3.1/V5-His pcDNA3.1/V5-His-TOPO pcDNA3.1D/V5-His-TOPO
pCDNA3.2/V5/GW/D-TOPO and pCDNA6.2/V5/GW/D-TOPO vectors
pcDNA6/BioEase-DEST
pcDNA4/HisMax
pcDNA6.2/nGeneBLAzer-DEST
pcDNA6.2/nGeneBLAzer-GW/D-TOPO
pRc/CMV and pRc/CMV2
pRc/RSV pZeoSV
pEF
pBudCE4.1
ALTERNATE PRODUCTS & COMPATIBILITY
PRODUCT DOCUMENTATION
REFERENCES
PRODUCT NAME & CATALOG NUMBER
Untagged Vectors
Epitope tagged Vectors
Gateway-adapted Destination Vectors
Kits
COMPONENTS
Untagged Vectors
Epitope tagged Vectors
Gateway-adapted Destination Vectors
Kits
ASSOCIATED PRODUCTS
RELATED TECHNICAL SUPPORT NOTES
PRODUCT DESCRIPTION
(back to Table of Content)
Vectors-General description
Promoters
Fusion Tags
Selection Markers
Nomenclature of vectors
Vectors-General description
(back to Table of Content)
(back to Product Description)
Vectors for constitutive, high level expression in mammalian cells
Choice of promoter for constitutive, high-level expression, choice of epitope tag for easy detection and
polyhistidine (6xHis) or GST tag for rapid purification (with the exception of the 6 pCDNA3.1 untagged vectors)
and choice of selection marker for generating stable cell lines, thus allowing for expression of more than one gene
in a cell line
Available as restriction enzyme cloning (three reading frames provided for most tagged vectors), TOPO TA,
Directional TOPO and Gateway versions.
To study protein expression by transient transfection as well as by stable integration into the genome
Useful for studying protein expression involving post-translational modifications, not seen in E.coli, yeast and
insect cells
Promoters
(back to Table of Content)
(back to Product Description)
CMV: Immediate-early Cytomegalovirus virus promoter for high-level expression in a wide variety of mammalian
cell lines
EF1-1α: Human elongation factor 1α-subunit promoter for high-level expression
Ubc: Human ubiquitin C promoter for high-level expression that is equivalent across a broad range of species and
tissue types
SV40: Simian virus 40 promoter for high -level expression. Permits replication in cell lines expressing the large T
antigen
PGK: Murine Phosphoglycerate Kinase-1 promoter for long-term persistent expression in cells that are susceptible
to promoter silencing from methylation or histone deacetylation , such as undifferentiated embryonic stem (ES)
cells
Fusion Tags
(back to Table of Content)
(back to Product Description)
See also Epitope-tagged antibodies application note for additional details on applications involving Myc, 6xHis, V5, and
Xpress epitopes
V5: Low background, efficient Western blot detection, immunoprecipitation and immunostaining
Xpress: Efficient Western blot detection and immunoprecipitation
myc: Efficient Western blot detection, immunoprecipitation and immunostaining
6xHis: Efficient Western blot detection, immunoprecipitation and protein purification
GST: Efficient Western blot detection, immunoprecipitation and protein purification
BioEase: Efficient Western blot detection, immunostaining and protein purification
Lumio: Small (six amino acid) tag for in vivo and in vitro protein detection and localization. The small size reduces
the likelihood that the tag will interfere with protein function.
Fluorescent protein: Cycle 3 Green fluorescent protein (Cycle 3 GFP), EmGFP (Emerald Green fluorescent protein)
or YFP (Yellow fluorescent protein) for fluorescence detection and localization in living or fixed cells.
Selection Markers
(back to Table of Content)
(back to Product Description)
Neomycin: Reliable and convenient selection using widely used selection agent, Geneticin
Blasticidin: Rapid selection
Zeocin: Efficient, high potency selection
Hygromycin: Different mode of action than Geneticin or Zeocin, hence useful for dual selection
Nomenclature of vectors
(back to Table of Content)
(back to Product Description)
Promoter Selection Marker Fusion Tag
pcDNA = CMV 3.1, 3.2 or EF1 = /His = N-terminal His
Geneticin resistance tag
pEF = EF-1α 4 = Zeocin resistance /myc-His = C-
terminal myc-His tag
pUB = Ubiquitin 6, 6.2 = Blasticidin /V5-His = C terminal
resistance V5-His tag
/His-Xpress = N-
terminal His-Xpress
tag
SHIPPING CONDITIONS
(back to Table of Content)
Lyophilized vectors are shipped at room temperature; Expression kits are shipped on dry ice.
STORAGE CONDITIONS
(back to Table of Content)
Lyophilized vectors are stable at room temperature until reconstituted, however after reconstitution (in TE) store at 4oC for
short term and -20oC for long-term storage. Kits should be stored at -20oC for the vector box, whereas competent cells
should be stored at -80oC upon receipt.
STABILITY
(back to Table of Content)
All vectors and kits are guaranteed stable for six months.
QC SPECIFICATIONS
(back to Table of Content)
All supercoiled vectors are qualified by restriction endonuclease digestion using enzymes described in vector-specific
manuals. All TOPO vectors are qualified using the control reagents in the kit to ensure cloning efficiencies as stated in the
vector-specific manuals. All Gateway-adapted DEST vectors are qualified for functionality in an LR recombination assay
using Gateway LR Clonase Enzyme Mix. The ccdB gene is assayed by transformation using an appropriate E.coli strain.
The control vectors are qualified by restriction endonuclease digestion.
PROTOCOL AND APPLICATION NOTES
(back to Table of Content)
General information
Common vector elements
Elements important for efficient eukaryotic translation
Kozak sequence
Promoters
CMV promoter
SV40 promoter
EF-1α promoter
Ubc promoter
PGK promoter
Promoter strength comparison
Polyadenylation and Transcription termination
Origin of Replication: pUC ori and pBR322 ori
Untranslated regions (UTRs)
Enhancers
Antibiotic Selection Markers for Eukaryotic Selection and for Cloning in Bacteria
Expression yields of specific proteins
Molecular weights of Epitope tags and Control proteins
Vector specific information
pCDM8
pcDNA1, pcDNA1.1, pcDNA1/Amp, pcDNA1.1/Amp and pcDNA1/Neo
pcDNA3 and pcDNA3.1 Difference between pcDNA3 and pcDNA3.1
pCDNA3.2 and pCDNA6.2
pDEST26
pDEST27
pCR3.1 pCDNA3.1 His
pCDNA3.1 myc-His
pcDNA3.1/V5-His pcDNA3.1/V5-His-TOPO pcDNA3.1D/V5-His-TOPO
pCDNA3.2/V5/GW/D-TOPO and pCDNA6.2/V5/GW/D-TOPO vectors
pcDNA6/BioEase-DEST
pcDNA4/HisMax
pcDNA6.2/nGeneBLAzer-DEST
pcDNA6.2/nGeneBLAzer-GW/D-TOPO
pRc/CMV and pRc/CMV2
pRc/RSV pZeoSV
pEF
pBudCE4.1
General information
(back to Table of Content)
(back to Protocol and Application Notes)
Common vector elements
Elements important for efficient eukaryotic translation
Kozak sequence
Promoters
CMV promoter
SV40 promoter
EF-1α promoter
Ubc promoter
PGK promoter
Promoter strength comparison
Polyadenylation and Transcription termination
Origin of Replication: pUC ori and pBR322 ori
Untranslated regions (UTRs)
Enhancers
Antibiotic Selection Markers for Eukaryotic Selection and for Cloning in Bacteria
Expression yields of specific proteins
Molecular weights of Epitope tags and Control proteins
Common vector elements
(back to Table of Content)
(back to Protocol and Application Notes)
(back to General Information)
Elements important for efficient eukaryotic translation
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Common vector elements)
Both the 5' cap structure and the spacing between the cap and the initiation ATG codon affect ribosome binding
and initiation of eukaryotic translation.
In particular, the sequence immediately surrounding the initiation codon may be important for efficient
translation initiation.
Kozak sequence
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Elements important for efficient eukaryotic translation)
Kozak analyzed 699 5' untranslated sequences from vertebrate mRNAs and derived a consensus sequence
that is believed to be important for efficient initiation of translation (1). It is G/ANNATGG, where ATG is
the initiation codon.. Point mutations in the nucleotides surrounding the ATG have been shown to
modulate translation efficiency (2). A purine (A/G) in -3 position has a dominant effect - expression levels
can be reduced upto 95% when the -3 position is changed from a purine to a pyrimidine (C/T) and further,
with a pyrimidine in -3 position, translation becomes more sensitive to changes in -1, -2 and +4 positions.
The +4 position has less influence on expression levels where approximately 50% reduction is seen
Note: Yeast do not follow this rule (3). The optimal Kozak sequence for Drosophila differs slightly
(C/AAAA/CATG) (4).
For expression of a novel portion of a gene, a non-eukaryotic gene or a gene with an undefined eukaryotic
initiation sequence, optimizing with Kozak may help (1,5,6). If concerned about expression, it is advisable
to test two constructs, one with the native start site and the other with a consensus Kozak,
In general, eukaryotic translation initiation at non-ATG codons is extremely rare and even if it does occur,
the initiation is inefficient.
Promoters
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Common vector elements)
CMV promoter
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Promoters)
The immediate-early CMV (Cytomegalovirus) promoter is used in our vectors. In addition to the CAAT
and TATA boxes, the promoter contains sequence homologous to base pairs 137 to 724 of the sequence
submitted by Boshart et al (GenBank Accession # K03104). The complete enhancer region is contained
between base pairs 214 and 620 of this sequence. Therefore, by this definition, the promoter could be said
to be complete. Please note that the promoter does not contain an intron (some people may believe that a
complete promoter must contain an intron). This has not been demonstrated to be needed in all cases of
expression.
The CMV promoter in our vectors does not contain a chimeric or other intron. Although some reports
suggest that the presence of an intron increases expression levels, our data show higher expression levels
with pcDNA3.1 than from a similar vector containing a chimeric intron (Expressions 5.3, page 10).
Repression of CMV promoter - Typically the CMV promoter is not repressed in 293 cells due to the
presence of the adenovirus E1a gene. CMV repression is observed in other cell types (e.g. 3T3) when it
integrates in a genomic location that causes it to shutdown.
Comparison to other CMV promoters - We have made many comparisons of our CMV promoter to others
on the market and ours either out-performs or is equivalent to the others. Additional sequences between the
TATA box and the transcription start site) typically do not contain any regulatory or transcription factor
binding sites, so their actual base composition is probably irrelevant. They are more just for spacing, with
typically ~25 bp of sequence between the TATA box (where the transcription machinery is assembled) and
where they actually touch down and begin transcription.
Cryptic E. coli promoter - likely to be somewhere in the CMV promoter. When the gene of interest is in
the correct orientation for eukaryotic expression, the cryptic E. coli promoter will often express the gene in
E. coli. The level of toxicity to E. coli will depend upon the particular gene product and upon the
efficiency of translation initiation. One way of getting around this problem is by engineering a prokaryotic
transcription terminator , upstream of the gene of interest. This will result in reduced expression in E. coli
without altering eukaryotic expression.
CMV promoter in yeast - The CMV promoter works in S. pombe, but is essentially non-functional in S.
cerevisiae (anything with a TATA box that isn't specifically repressed will give some level of expression in
S. cerevisiae, but not enough that one can actually detect, say, with a GFP tag). There are yeast "tricks"
that involve co-tranformation and selection for homologous recombination between vectors that can be
used to try to express a library created in a mammalian vector, in S. cerevisiae, but in the general case, it
would be much better to subclone the gene of interest in a yeast expression vector.
The CMV promoter has a broad host range that includes a wide variety of mouse tissue and cell types
(7,8,9) and several human cell lines including B-lymphoblastoma (10), a lung cancer cell line (11),
embryonic kidney cells (12), breast cancer cell lines (13) and placenta cells (14). Expression using CMV
promoter-based vectors has also been observed in a canine thymus cell line (15), Xenopus oocytes (16),
quail embryo fibroblasts and avian bursal lymphomas (17), D. melanogaster (insect) cells (18) and yeast
(19). The CMV promoter does not seem to work in T24 and HCV29 human bladder urethelium carcinoma
cell lines but SV40 exhibits high activity in these cell lines. Both T24 and HCV29 cell lines originated
from human transitional cell carcinoma of bladder urethelium.
The CMV promoter is weak in B cells and so is the SV40 promoter. This may pose a problem if selection
is under this promoter, resulting in poor expression of the protein of interest. Recommend EF-1α promoter
or UbC promoter.
Augmenting or altering expression from CMV promoter
Sodium butyrate in cell culture increases transcription of genes driven by the CMV promoter (and
certain other viral promoters). One of the activities of sodium butyrate is inhibition of deacetylation.
Histone deacetylation is a frequently used endogenous method for silencing genes. It is likely that
sodium butyrate increases transcriptional activation at the CMV promoter by inhibiting deacetylation
of histones. One cannot guarantee that sodium butyrate will increase transcription but it may if it
makes the site of integration of the CMV promoter - gene of interest more accessible. The drawback is
that the transcriptional increase is not specific to the CMV promoter making the results a little suspect
(20,21,22,23,24).
Retinoic acid - Cells transfected with CMV promoter-containing vectors and subsequently treated with
retinoic acid to induce differentiation show up-regulation of expression of the target gene (25).
PHA and PMA - The CMV promoter is constitutively active in many cell types. However, in T-cell
derived cell lines such as Jurkat, KGI and K562, activation of the cells is required for expression. In
Jurkat cells, maximum expression is achieved with the lectin PHA-L (phytohemagglutinin) and the
phorbol ester PMA (phorbol myristate acetate) whereas in KGI and K562 cells, PMA alone is
sufficient. In Jurkat cells, addition of PHA and PMA to the "post-transfection replacement medium" at
a final concentration of 1 ug/ml and 50 ng/ml, respectively, induces promoter activity and gene
expression (probably mediated by protein kinase C). PHA/PMA are not absolutely required, but
expression levels may be 5X-20X lower if they are not added (FOCUS 18:2, p.45).The activation is
general and will probably affect many promoters. Other T-cells may also need this stimulation.
SV40 promoter
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Promoters)
The SV40 (Simian Virus 40) promoter in our vectors contains the SV40 enhancer promoter region and
origin of replication for high-level expression and replication in cell lines expressing the large T antigen.
It contains two 72bp SV40 enhancer repeats (26).
SV40 ori/Episomal replication/Large T Antigen/Stability of cell lines
Mammalian vectors that contain the SV40 polyoma ori (usually part of the SV40 early promoter in our
vectors) replicate episomally, but only in cells that express the SV40 large T antigen (e.g. COS-7 and
293T cells). They will not replicate episomally in the absence of the SV40 large T antigen.
Generating stable lines in cells expressing the SV40 large T antigen is very difficult, if not impossible,
with any plasmid that contains the SV40 origin/promoter. This is because the SV40 large T antigen
induces DNA replication at the SV40 ori in the vector sequence. If this occurs after the vector has
integrated into the genome, it will result in isolated regions of the chromosome trying to replicate
illegitimately, leading to chromosomal duplications and generally messing up the cell's genome. The
best recommendation would be to use a cell line that does not express the SV40 large T antigen.
Deleting the origin could be an option, (50), however, this may affect promoter activity. Transient
transfection of SV40 ori-containing plasmids into cells expressing the SV40 large T antigen results in
replication of the plasmid (without hurting the host cell's chromosomes) and therefore an amplification
of the gene of interest and subsequently very high levels of expression. Hence, we recommend the
SV40 ori-containing vectors for transient use only in SV40 large T antigen-containing cells, but they
can be used both transiently and stably in cells that do not have the SV40 large T antigen.
There is a sequence discrepancy for the SV40 ori/promoter region between pcDNA3.1 (also pcDNA3)
and its parent vector pRcCMV. pRcCMV has the essential sequences for SV40 ori including the Sfi I
site which is critical for activity. The SV40 ori in pcDNA3.1differs in sequence at this exact location
(the Sfi I site) - John Comiskey mutated that Sfi I site a couple of years ago (with a single base change)
when pcDNA3 was made from pRcCMV and it has been sequenced and tested in CHO cells. As far as
we have seen, the SFi I site, per se, is not essential for replication in CHO cells as long as the spacing
within the origin isn't changed too much.
To extract episomal plasmids, use a standard HIRT prep..
The SV40 promoter is weak in B cells. The same applies to the CMV promoter. This may pose a
problem if selection is under this promoter, resulting in poor expression of the protein of interest.
Recommend EF-1α promoter or UbC promoter.
The SV40 promoter expresses fairly well in Jurkat cells under transient conditions and also when
stably integrated into a ‘good� locus (transcriptionally active locus).
EF-1α promoter
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Promoters)
EF-1α (Elongation Factor-1α) promoter is a strong, constitutive non-viral promoter (27,28,29,30,31). The
EF-1α gene encodes EF-1α enzyme that catalyzes the GTP-dependent binding of aminoacyl-tRNA to
ribosomes. EF-1 α is one of the most abundant proteins in eukaryotic cells and is expressed in almost all
kinds of mammalian cells. The EF-1 α promoter exhibits a strong activity, higher than that of viral
promoters such as SV40 and RSV (32) and, on the contrary to the CMV promoter, yields persistent
expression of the transgene in vivo (33). In our experience, EF-1α and CMV express nearly equivalently in
293 cells when plasmids are transiently transfected and gene expression is measured 2-3 days later.
All our EF-1α promoter based vectors contain intron 1 of the EF-1α gene. In the vector maps, intron 1
runs from base 706 to 1644. The transcriptional start site is not yet determined, but in general starts about
20-25 bases downstream of the TATA box, which in this case is located at bases 645 to 649.
Developmental expression from the EF1α promoter (34,35)
Ubc promoter
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Promoters)
Ubc (Human Ubiquitin C) promoter provides high-level expression that is equivalent across a broad range
of species and tissue types (36,37)
The activity of the UbC promoter is typically about 50% the activity of CMV and EF-1α promoters in 293
cells. Other weaker promoters (that we don't sell) include HSV TK and cellular PGK promoters.
PGK promoter
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Promoters)
PGK (Murine Phosphoglycerate Kinase-1) promoter is a ubiquitous housekeeping promoter that has been
shown to promote long-term persistent expression (53), and may provide consistent expression in cells that
are susceptible to promoter silencing from methylation (54) or histone deacetylation (55), such as
undifferentiated embryonic stem (ES) cells (53, 56).
Promoter strength comparison
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Promoters)
In most adherent mammalian cells, eg. CHO cells, promoter strength of CMV > EF-1α > UbC. EF-1α is almost
always stronger than UbC, but sometimes only a little bit stronger
Comparative expression levels
Vector ng CAT/mg total protein (2 experiments each)
pCDNA3.1 432, 715
pCR3.1 129,139
pRC/CMV2 374,218
pCDNA1.1 27,40
Expression in pCR3.1 appears to be about 3-4 fold lower than that in pCDNA3.1.
Summary of promoter activities as a percent relative to activity of SV40 immediate early promoter
This table represents a summary of the data found in the papers listed below under references. The data
shown below is intended as a general guide only. The CAT assay values for each set of data have been
converted to percent relative to SV40 promoter activity (SV40 promoter activity is assumed to be 100%).
For some cell lines, results from several papers have been averaged. Not every paper tested all promoters
with each cell line. In addition, there are reports from researchers that the EF-1α promoter offers sustained
expression in some cell lines that tend to turn the CMV promoter down over time, such as HeLa cells.
Cell Line Source CMV RSV SV40 EF-1α Reference
Cos-7 Monkey kidney 1404 80 100 205 38,39,41,42,45
Human cervical
HeLa carcinoma 232 67 100 170 39,40,41,42,43,45
NIH-3T3 Mouse fibroblast 150 160 100 215 39,40,44,45
CHO Hamster ovary 643 71 100 39,41,42
CV1 Mouse kidney 1295 9 100 39
Bowes
Melanoma Human melanoma 1936 48 100 39
CEF Chick fibroblast 1660 1280 100 40
BHK-21 Baby Hamster kidney 50 100 100 41
Human embryonic
HEK-293 kidney 2130 1584 100 41,43
Cell Line Source CMV RSV SV40 EF-1α Reference
Human umbilical
IVEC vascular endothelium* 1429 4571 100 41
Human brain
endothelium*
HBEC-90 2500 1750 100 41
TR2 Mouse oligodendritic* 263 368 100 41
Rat mammary
REMC epithelium 90 100 100 44
L929 Mouse 143 100 396 45
CHU-2 Human 53 100 167 45
PU5-1.8 Mouse macrophage 200 128 100 195 45
LTK Mouse fibroblast 800 100 42
N2A Mouse neuroblastoma 200 100 42
C6 Rat astrocytoma 225 100 42
33.1.1 Mouse pre-B cell� 1500 100 42
K46 Mouse B-lymphoma 50 100 42
J558L Mouse plasmacytoma 100 100 42
Mouse
teratocarcinoma*
IC11 200 100 42
* Transformed with SV40 Large T antigen
� Transformed with Abelson virus
In-house evidence that CMV and SV40 promoters function with different strengths in 3T3 cells and
S2 cells
3T3 cells and S2 cells were transfected with pTracer-CMV2 and pTracer-SV40 vectors. In 3T3 cells,
good fluorescence was seen within 24 hours with pTracer-SV40. Fluorescence was barely discernible in
pTracer-CMV transfected 3T3 cells even after 4 days. However, good fluorescence was seen in dying 3T3
cells (transfected with pTracer-CMV2) as early as 24 hours post-transfection. In S2 cells, pTracer-SV40
fluoresced quite nicely, indicating that the CMV promoter is functional in this cell type, which is contrary
to popular belief. pTracer-CMV was again just barely visible, more so in dying cells. This indicates that
the EF1-α promoter is less funtional in this cell line.
Polyadenylation and Transcription termination
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Common vector elements)
In our mammalian expression vectors, transcription termination is provided by the BGH (Bovine growth
hormone) polyA, SV40 polyA, or TK (Thymidine kinase) polyA site downstream of the multiple cloning
sequence (MCS).
There is evidence of specific termination factors involved with the polyA polymerase in transcription
termination, though none have been well-characterized (46). The primary transcript for many mRNAs
extends well beyond the polyadenylation site.
Polyadenylation in eukaryotes occurs at a specific consensus sequence, AAUAAA, in the mRNA. The polyA
polymerase cleaves after the U residue and adds a string of adenine residues, typically 50-250 in higher
eukaryotes (46).
Eukaryotic transcription termination signals are poorly defined whereas in prokaryotes, distinct transcription
termination signals are recognized by the cell machinery.
Transcription in yeast appears to terminate at AT-rich regions and is thought to be due to the formation of
secondary structure which inhibits further transcription (47).
If there is evidence for a single transcriptional product from a vector, it usually indicates that there is a
transcription termination signal in the vector. If not, a smear of many different bands would be obtained.
It is common for plasmids to have some gratuitous sequence (unpredictable a priori) that functions as a
termination signal. It is possible to get expression of a cloned fragment in CMV-containing vectors from the
Amp promoter, an observation that suggests that there isn't a transcription termination signal in the CMV
promoter itself.
BGH (Bovine growth hormone) polyA
The BGH polyA signal (bases 1019-1250) is the sequence that allows for polyadenylation.
There is no intron in the BGH polyA sequence.
SV40 polyA
The SV40 early polyA signal is used in our vectors. The SV40 early and late polyA signals are actually
the same chunk of DNA - early on one strand and late on the other. So it is the orientation of the sequence
relative to the ORF being polyadenylated that determines whether it is the early or late SV40 polyA.
The SV40 polyA sequence in our vectors is derived from the Genbank SV40 genome sequence. The
SV40 polyA is a region of the SV40 genome where transcripts coming from both directions terminate -
small and large T antigens from counterclockwise direction and VP1, VP2 and VP3 from clockwise
direction. Hence, it functions as a transcription terminator and poly A signal in either orientation.
Critical sequences for efficient function of the SV40 early polyA - Efficient cleavage at the early site
requires an element between 5 and 18 nucleotides downstream of the cleavage site, but removal of
sequences upstream of the early AAUAAA hexanucleotide has no effect on cleavage efficiency (48). For
example, the AAUAAA in pcDNA3 is at 3149-3155. This would put the required sequences no further
downstream than 3173. BsmI cuts at 3200 so presumably there will be a limited impact on the efficiency
of the poly A sequence. There could still be a diffuse effect due to the loss of a less critical downstream
sequence.
In some of our early vectors (now discontinued), the SV40 ori/promoter contains a splice site (49).
If labelled as "SV40 intron/pA" : element contains an SV40 intron.
If labelled as "SV40" :element does not contain an SV40 intron.
If labelled as "SV40 ori" : element does not contain an SV40 intron.
If labelled as "SV40 pA" : element does not contain an SV40 intron.
For example:
pcDNA1 SV40 intron/pA
pcDNA1/amp SV40 intron/pA
pCDM8 SV40 intron/pA
pcDNA3 none
pRc/CMV none
pRc/RSV none
pcDNA3.1-derived vectors none
Origin of Replication: pUC ori and pBR322 ori
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Common vector elements)
Our mammalian expression vectors contain either the pUC ori (high copy number) or pBR322 ori (low copy
number). However, the vectors with pBR322 ori have been discontinued and all of our currently available
mammalian expression vectors contain the pUC ori.
Both our low copy and high copy plasmids are derived from ColE1. The high copy plasmids, however, are
missing the ROP protein which normally serves to reduce copy number. One could say that a pUC ori is
derived from a mutated ColE1.
Untranslated regions (UTRs)
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Common vector elements)
Kozak surveyed 699 eukaryotic 5' untranslated regions and revealed that most are 50-150 bp in length (1).
However, in some cases, these 5' untranslated regions are longer due to the presence of an intron which is
subsequently removed before translation initiation (1). The fact that only 4 of these 699 eukaryotic transcripts
do not have 5' untranslated regions indicates that these 5' untranslated regions may be needed for proper
translation initiation. Since translation initiation in eukaryotes is not well characterized, it is recommended that
the 5' untranslated region be kept to 50-100 base pairs in length and that mRNA secondary structure formation
be minimized in this region (51).
Untranslated sequences (including introns, 3' and 5' untranslated regions) do not, as a general rule, improve
expression. However, if there is evidence to suggest that certain gene-specific sequences improve the
efficiency of ectopic expression of specific genes, then it may be worthwhile to include those sequences during
cloning. However, in nearly all cases, no untranslated sequences are necessary for high level expression from
our vectors.
Enhancers
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Common vector elements)
Enhancers are genetic elements that, although not absolutely necessary for expression, act to increase the
expression of a gene from a promoter through interactions with different transcription factors. An enhancer
can be located upstream, downstream, or even overlapping the promoter, as long as it is in cis with the
promoter. The effect of a promoter/enhancer combination on expression of a given gene depends upon the cell
line (52).
Invitrogen’s CMV and SV40 promoters contain enhancer regions. See sections in this note above describing
specific promoter characteristics
Antibiotic Selection Markers for Eukaryotic Selection and for Cloning in Bacteria
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Common vector elements)
Eukaryotic Selection Markers
In bacteria, Neomycin resistance genes are dominant and are located on transposons Tn601 (Tn903) and
Tn5. The neomycin resistance gene from Tn601 (Tn903) is referred to as aminoglycoside
phosphotransferase 3� (I) or APH (3�) I and that from Tn5 is referred to as aminoglycoside
phosphotransferase 3� (II) or APH (3�) II. APH (3�) I and II encode the enzymes neomycin
phosphotransferase I and II respectively, which confer resistance to various aminoglycoside antibiotics,
including kanamycin and neomycin, in bacteria.
The Neomycin resistance gene in our mammalian expression vectors is bacterial in origin (derived from
Tn5 Neo) but is efficiently expressed in eukaryotic cells. Introduction of the Neomycin resistance gene
into eukaryotic cells confers resistance to Geneticin (G418 Sulfate), enabling the cells to grow in media
containing Geneticin.
Geneticin (G418 Sulfate) is an aminoglycoside related to gentamycin, neomycin, and kanamycin. It is
toxic to normal prokaryotic and eukaryotic cells.
Neomycin sulfate is an antibiotic that is active against gram positive and gram negative bacteriaIt is
typically used at a concentration of 50 ug/ml. It is generally stable in media stored at 37C for 5 days.
Neomycin sulphate cannot be used instead of Geneticin in mammalian cells since Neomycin sulphate
does not cross the cell membrane and hence does not enter the cell.
The Neomycin resistance gene in our mammalian expression vectors is not functional in E coli because the
bacterial promoter has been completely removed.
All of Invitrogen's antibiotics (G418, Geneticin, Zeocin, Hygromycin and Blasticidin) can in theory be
used together. Puromycin belongs to the same familiy as Blasticidin, hence, puromycin and blasticidin
may not be compatible, however this has not been tested in-house.
Selection markers for cloning in bacteria
Promoter for Ampicillin resistance sequence below is the sequence upstream of the ATG that contains the
promoter. The promoter and Shine-Delgarno sequence are shown underlined.
GTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAA
ATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAG
AGT
Promoter for Kan resistance: The kanamycin gene is driven by the ampicillin promoter.
Ampicillin cannot be used for selection of eukaryotic cells if put under control of a eukaryotic/viral
promoter. B-lactamase is targeted to (and secreted through) specific linkages in the bacterial cell wall. A
eukaryotic cell lacks a cell wall and, therefore, cannot be selected using ampicillin.
Expression yields of specific proteins
(back to Table of Content)
(back to Protocol and Application Notes)
(back to General Information)
Cells were transiently transfected using the Calcium Phosphate Transfection Kit. Expression data is as follows:
Vector COS Cells HeLa Cells
(ng CAT/mg Total (ng CAT/mg Total
Protein) Protein)
pcDNA3/CAT 261 434
304 343
pRc/CMV/CAT 72 165
63 145
pSV/CAT 5 98
5 145
pB/CAT 0.1 0.4
0.5
Cells only 0.6 0.1
0.2
CAT protein levels were determined using an enzyme linked immunosorbent assay (ELISA) kit. The colorimetric assay
is capable of detecting the fully native form as well as the denatured, enzymatically inactive form of the CAT protein.
This method is comparable to the radioisotopic methods. This assay does not determine enzyme activity.
Molecular weights of Epitope tags and Control proteins
(back to Table of Content)
(back to Protocol and Application Notes)
(back to General Information)
Epitope tags
V5 : 1.5 kDa
V5-His : 3 kDa
HisG : 1 kDa
His (C-term) : 1 kDa
Xpress : 1 kDa
His-Xpress : 5 kDa
c-myc : 1.1 kDa
Control proteins
LacZ : 117 kDa, 3 kb
CAT : 32 kDa, 800 bp
GFP : 7 kDa
HSA : 67 kDa, 2 kb
Vector proteins
she-ble (zeocinR) : 13.7 kDa
kdRxR subunit : 56 kDa
Thioredoxin : 11.7 kDa
sFv : 34 kDa
PDGF : 42 kDa
Vector specific information
(back to Table of Content)
(back to Protocol and Application Notes)
pCDM8
pcDNA1, pcDNA1.1, pcDNA1/Amp, pcDNA1.1/Amp and pcDNA1/Neo
pcDNA3 and pcDNA3.1 Difference between pcDNA3 and pcDNA3.1
pCDNA3.2 and pCDNA6.2
pDEST26
pDEST27
pCR3.1 pCDNA3.1 His
pCDNA3.1 myc-His
pcDNA3.1/V5-His pcDNA3.1/V5-His-TOPO pcDNA3.1D/V5-His-TOPO
pCDNA3.2/V5/GW/D-TOPO and pCDNA6.2/V5/GW/D-TOPO vectors
pcDNA6/BioEase-DEST
pcDNA4/HisMax
pcDNA6.2/nGeneBLAzer-DEST
pcDNA6.2/nGeneBLAzer-GW/D-TOPO
pRc/CMV and pRc/CMV2
pRc/RSV pZeoSV
pEF
pBudCE4.1
pCDM8 (back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
This vector has been discontinued.
The vector is different from the one that was sent to use by Brian Seed in that an Ssp I to Ssp I fragment has been
deleted in the SV40 poly A. The same deletion is present in pcDNA1and pcDNA1/Neo, in the SV40 polyA after the
MCS, but not in the SV40 polyA after the Neomycin gene. The vector that was sent to us by Brian Seed does not
have the deletion, but whether his sequence was wrong from the start or whether the deletion came later is unknown.
SV40 ori is enhancer-less.
pCDM8 splice site and polyA were derived from pSV2. pSV2 carried the SV40 Small T antigen which provided
less efficient splicing than the SV40 Large T antigen or β-globin large T antigen..
pcDNA1, pcDNA1.1, pcDNA1/Amp, pcDNA1.1/Amp and pcDNA1/Neo (back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
These vectors have been discontinued.
A restriction enzyme digest using Apa I will be able to differentiate between the vectors. Expected results are as
follows: pcDNA1: 4033bp (linear) pcDNA1/Amp: 3621bp and 1180bp
The pCDM8 reverse primer (Cat. #N570-02, discontinued) will work as a 3' primer for the pcDNA1 vectors.
pCDM8 Reverse Primer: 5' TAAGGTTCCTTCACAAAG 3'.
Low yields are common : pCDNA1/Neo expresses kanamycin resistance very weakly and the plasmid usually
forms dimers which run very high on the gel. Also, the plasmid is grown in MC1061/P3 cells, and the residual P3
plasmid itself is kanamycin resistant, and will transform alone. Individual colonies should be picked and checked.
Putative transcriptional start site in pcDNA1.1/Amp : the transcriptional start site has not been determined
experimentally. It is based on the start site for the native CMV promoter or rather assumed to be at the same
relative position. It is not likely that the transcription start site is affected by the insert in the MCS.
The SV40 origin in these vectors is the same as that in pCDM8 (enhancerless, 163 bp)
SV40 intron and polyA start and stop positions are the same in these vectors as they are in pcDM8.
pcDNA I has an early SV40 pA.
pcDNA3 and pcDNA3.1 (back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
pcDNA3 has been discontinued and has been replaced by pcDNA3.1.
pcDNA3.1 is derived from pcDNA3 which in turn is derived from pRc/CMV.
There is a unique BsaBI site in pcDNA3.1, right before the Neomycin resistance gene, that is not present in
pcDNA3.1/Zeo. This site can be used to distinguish between these two vectors by restriction analysis.
In pcDNA3.1(+), pUC origin (according to KO, Harry, and PNAS 71:2260-2264) is unidirectional. Alignment of
bp 3618-4291 of pcDNA3.1 with pBR322 (we know which way the origin runs in pBR322 as per NEB catalog Pg
230) results in a perfect match, indicating that the pUC origin runs counterclockwise toward the SV40 polyA.
In pcDNA3.1, the SV40 poly A recognition site for the Neomycin resistance gene is AAATAAA and is located at
3148 and 3177 in the SV40 Poly A.
pcDNA3.1 has no pBR322 sequences. The Ampicillin resistance gene and ori in pcDNA3.1 come from pUC.
Splicing sites in pcDNA3 vector: None that have been experimentally mapped.
The putative transcription start site from the CMV promoter is around 30 nt 5� of the starting site of the T7
promoter priming site. The putative transcription start site from the T7 promoter (if customers want to use the
vector for in vitro transcription) is the first G at the 3� end of the T7 promoter priming site.
pcDNA3.1/Zeo vectors have the bacterial EM7 promoter for expression of the zeocin resistance gene in E. coli,
however, the EM7 promoter is not shown on the vector map.
Difference between pcDNA3 and pcDNA3.1
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
pcDNA3 is no longer available. pcDNA3.1 is a direct replacement of this mammalian expression vector.
pcDNA3.1 was derived from pcDNA3 as follows. The middle of the original pcDNA3 polylinker contained
homology to a hairpin mRNA structure which involved the Eag I, Not I, and both BstXI sequences. The hairpin
would only have affected expression of genes cloned downstream of the Not I site, if at all.
pCDNA3.2 and pCDNA6.2
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
These vectors have a TK polyadenylation site after the cloning site, as indicated by.2 in the names of the vectors.
pDEST26
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
This is an original LTI vector and is not derived from pcDNA. It has an N-terminal 6xHis tag which is not a HisG
tag.
pDEST27
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
This is an original LTI vector and is not derived from pcDNA. It has an N-terminal GST tag.
In this vector, the ClaI site at 3632 is dam methylated, whereas the ClaI site at 5650 is not. This will explain single
cutting by ClaI when DNA is propagated in dam+ cells.
pCR3.1
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
Unidirectional version was discontinued March 2004. Bidirectional version was discontinued August 2004
The kanamycin resistance gene is driven by the Ampicillin promoter somewhere in the region of 4470-4586. There
is also a weak promoter in the region 3535-3566 just before the SV40 promoter. This was tested in the lab and
pCR3.1 is Ampicillin and Kanamycin resistant.
pCDNA3.1 His
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
Some anti-T7 antibodies (e.g. one is available from Novagen) recognize the sequence MASMTGGQQMG which is
found immediately after the His-tag cleavage site in pcDNA3.1His A,B,C and pRSET. The DNA position is 953-
985 bp in pcDNA3.1HisA. The antibody is capable of immunoprecipitating any protein carrying this tag.
An easy way to remove the neo cassette from pcDNA3.1/His is to use Pvu II. This leaves a blunt ended backbone
ready to receive another selection cassette. When the selection swap is done this way you also lose the f1 origin. It
usually doesn't matter but be aware of it.
pCDNA3.1 myc-His
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
3 aa spacing between the two tags is probably not functionally important the space was for a restriction site, and
having the tags adjacent should work
distinguish between the A, B, and C versions of pcDNA3.1(+)/myc-his
ORF A ORF B ORF C
ApaI: one cut one cut no
SacII: no one cut no
BstEII: no no one cut
So if one cuts A, B and C with SacII and BstEII separately, the B would be the one linearized by SacII, the C would
be the one linearized by C alone, and the A would be the one that did not linearize with either.
pcDNA3.1/V5-His pcDNA3.1/V5-His-TOPO pcDNA3.1D/V5-His-TOPO
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
early stop codon is present In A version between BamHI and BstXI (in the MCS) presenting cloning difficulties to
some customers. If not careful about the cloning strategy, one could stop translation before the V5His tag..
pCDNA3.2/V5/GW/D-TOPO and pCDNA6.2/V5/GW/D-TOPO vectors
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
Tested in house: HLA and CAT genes were cloned into vector, transfected into CHO cells, and expression detected
with V5 antibody.
pcDNA6/BioEase-DEST
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
BioEase vectors include 72 amino acid sequence from K. pneumoniae that directs in vivo biotinylation of a specific
lysine residue. Proteins produced in the BioEaseÔ vectors are expressed as fusions to this sequence.
The entire 72 aa biotinylation sequence is necessary for efficient biotinylation in vivo.
In E. coli, the K. pneumoniae tag is recognized and efficiently biotinylated by the enzyme biotin protein ligase
(BPL) encoded by the birA gene (1). A similar system exists in mammalian cells
This system is designed for in vivo biotinylation. This means that the cell does the work, and the protein tag is
recognized by the cells internal machinery and is biotinylated. Biotin does not have to be added to the medium.
applications with SA-conjugates for visualization.
Vector backbone was prepared by digesting pcDNA6 His A with HindIII and KpnI, removing the His6, Xpress
epitope, and EK cleavage site. Biotag epitope was cloned in at HindIII and Kpn1.
GW version prepared by digesting pcDNA6/Biotag A vector with Acc65I and XbaI. The ends were blunted with
Klenow and the vector treated with CIAP. The vector was ligated with the prepared Gateway Cassette RFC.1.
pcDNA4/HisMax
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
A 2-5 fold increase in expression of GFP, LacZ, and Luciferase in pcDNA4/HisMax over the same vectors lacking
the SP163 sequence was observed. This increase in GFP expression was seen by western blot in HeLa, CHO, 293
and NIH3T3 cells. No absolute numbers were calculated for the amount of protein or RNA expressed from these
vectors in comparison to the controls.
spacing between the end of the SP163 sequence (......AAACC) and the ATG start codon is crucial. The last ACC
acts like a triplet repeat codon and needs to be in the same 'triplet frame' as the start codon [ie. AA ACC (NNN)xN
ATG...]. The number of triplets can be up to about 5-6 (15-18 bases), but any further away or a change of frame
severely perturbs the enhancement activity of SP163. Because of the variability surrounding different cloning
strategies, it was decided to provide an endogenous ATG in the best possible location relative to SP163.
pcDNA6.2/nGeneBLAzer-DEST
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
This vector is compatible with Tag on Demand technology
pcDNA6.2/nGeneBLAzer-GW/D-TOPO
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
This vector is compatible with Tag on Demand technology
pRc/CMV and pRc/CMV2
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
These vectors have been discontinued.
pRc/CMV is a parental plasmid of pRcCMV/2 which contained both SP6 and T7 promoters for in vitro
transcription.
pRc/CMV2, pRc/RSV, pZeo/SV2 designed for high-level stable and transient expression in eukaryotic hosts.
pRc/CMV is a parental plasmid of pRcCMV/2 which contained both SP6 and T7 promoters for in vitro
transcription.
contains the lac promoter: pCRII bases 1-200 (which contain lac promoter) align exactly with pRc/CMV bases
3589-3390. The orientation of this alignment is the opposite in the two plasmids relative to the graphic maps,
meaning that the lacZ promoter directs transcription in a clockwise direction in pcRII (1->200) and counter
clockwise in pRc/CMV (3589->3390) relative to the plasmid maps.
CMV sequence in pRc/CMV stops 15 bases short of the 5' start site of the mRNA in the native CMV. This is an
intronless version of the immediate early human cytomegalovirus promotor.
pRcCMV/CAT (5.5kb) positive control plasmid Constuction details: An 800bp HindIII fragment encoding CAT
was cloned into the HindIII site of pRC/CMV. The first ATG in this fragment is the correct ATG for the CAT open
reading frame. The sequence of the 5� end of CAT fragment between the HindIII site and ATG is:
AAGCTTCGACGAGATTTTCAGGAGCTAAGGAAGCTAAA ATG GAG AAA AAA ATC........
The 3' end of the BGH mRNA (to which the polyA tail is added) is position 1156 on the pRc/CMV map
pRc/RSV (back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
This vector has been discontinued.
pRc/CMV2, pRc/RSV, pZeo/SV2 designed for high-level stable and transient expression in eukaryotic hosts.
pRc/CMV is a parental plasmid of pRcCMV/2 which contained both SP6 and T7 promoters for in vitro
transcription.
PZeoSV
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
pRc/CMV2, pRc/RSV, pZeo/SV2 designed for high-level stable and transient expression in eukaryotic hosts.
pRc/CMV is a parental plasmid of pRcCMV/2 which contained both SP6 and T7 promoters for in vitro
transcription.
pEF
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
All the pEF vectors contain intron 1 of the EF gene. In the maps, the intron runs from base 706 to 1644 (inclusive).
The transcriptional start site is not yet determined, but in general starts about 20-25 bases downstream of the TATA
box, which in the EF vectors is located at bases 645 to 649.
pBudCE4.1
(back to Table of Content)
(back to Protocol and Application Notes)
(back to Vector specific information)
For expression of two separate C-terminal tagged proteins from the same vector.
There currently is no information available comparing the relative promoter strengths from this vector. The QC
data indicate that both promoters express well but how each promoter expresses relative to the other in a given cell
line should be determined by the investigator.
The earlier version of this vector, pBudCE4 (discontinued) has an ATG present at position 674 in the MCS.
Although this did not appear to affect translation of a cloned insert or the lacZ control, it has been changed to an
ATT in the replacement vector, pBudCE4.1.
PRODUCT DOCUMENTATION
(back to Table of Content)
Brochures Citations Cell lines
COA FAQ Licensing
Manuals MSDS Newsletters
Vector Data
REFERENCES
(back to Table of Content)
1. Kozak, Nucleic Acids Res. 1987, 15: 8125-8148
2. Kozak, Cell 1986,44: 283-292
3. Foreign Gene Expression in Yeast : A Review. Yeast, 1992, 8: 423-488
4. Caveneer, Nucleic Acids Res. 1987, 15(4): 1353-1361
5. Kozak , J. Cell Biology 1991, 115: 887
6. Kozak , J. Biol. Chem. 1991, 266: 19867
7. Furth P.A. et al, Nucleic Acids Res. 1991, 19: 6205-6208
8. Nabavi N. et al, Nature 1992, 360: 266-268
9. Sendtner M. et al, Nature 1992, 358, pp 502-504
10. Stefano K.A. et al, J. Virol. 1993, 67: 6707-6715
11. Unger T. et al, Molec. Cell. Biol. 1993, 13: 5186-5194
12. Glantz S.B. et al , J. Biol. Chem. 1993, 268: 12796-12804
13. Dixon K.H. et al, 267: 24140-24147
14. Mueller S.G. et al, J. Biol. Chem. 1994, 269: 1973-1980
15. Oberste M.S. et al , J. Virol. 1993, 67: 6395-6405
16. Berra E. et al, Cell 1993, 74: 555-563
17. Lutterbach B. et al, Molec. Cell. Biol. 1994, 14: 5510-5522
18. Sinclair J.H. et al, Nucleic Acids Res. 1987, 15: 2392
19. Toyama R. et al , FEBS Letters 1990, 268: 217-221
20. Effects of sodium butyrate, a new pharmacological agent on cells in culture. Mol. Cell Biochem. 1982, 42(2): 65-82
21. Kruh J.J., Cell Sci. 1995, 108(2):441- 455
22. White M.R. et al, Proc. Natl. Acad. Sci. U S A 1997, 94(11): 5798-5803
23. Chen W.Y. et al, Oncogene Res. 1988 3.3: 223-38
24. Tichonicky L. et al, Biol. Cell. 1990, 69.1: 65-67
25. Nakamura N. et al, BBRC 1998,243: 722-726
26. Sequence Requirements for Activation of Replication by the SV40 Transcriptional Promoter or Enhancer Elements.
Virology 1991, 180: 41-48
27. Uetsuki T. et al, J. Biol. Chem.1989, 264: 5791-5798
28. Kim et al, Gene 1990, 91: 217
29. Goldman et al, Biotechniques 1996, 21: 1013-1015
30. Mizushima S. and Nagata S., Nucleic Acids Res. 1990, 18: 5322
31. Gopalkrishnan R.V. et al, Nucleic Acids Res. 27(24): 4775-4782
32. Kim D.W. et al, Gene 1990, 91(2): 217-223
33. Guo Z.S. et al, Gene Ther. 1996, 3(9): 802-810
34. Gagneten S. et al, Nucleic Acids Res. 1997, 25(16): 3326-3331
35. Amsterdam A. et al, Dev Biol. 1995, 171(1):123-129
36. Schorpp M. et al, Nucleic Acids Res. 1996, 24: 1787-1788
37. Wulff B.S. et al, FEBS Lett. 1990, 261: 101-105
38. Cheng X. et al, Int. J. Radiat. Biol. 1995, 67(3): 261-267
39. Foecking M.K. et al, Gene 1986, 45(1): 101-105
40. Davis M.G. et al, Biotechnol. Appl. Biochem. 1988, 10(1): 6-12
41. Liu Z. et al, Anal. Biochem. 1997, 246(1): 150-152
42. Wenger R.H. et al, Anal. Biochem. 1994, 221(2): 416-418
43. Kronman C. et al, Gene 1992, 121(2): 295-304
44. Thompson T.A. et al, In Vitro Cell Dev. Biol. 1993, 29A(2): 165-170
45. Thompson E.M. et al, Gene 1990, 96(2): 257-262
46. Wahle E. and Keller W., Annu. Rev. Biochem. 1992, 61: 419-440
47. Henikoff S. and Cohen E.H., Molec. Cell. Biol. 1984, 4: 1515-1520
48. Molec. Cell. Biol. 1989, 9: 4248-4258
49. J. Biol. Chem. 1993, 268(28): 20904-20910
50. Hunter and Gurney, J. Vir. 1994, 68: 787-796
51. Pelletier J. and Sonenberg N., Cell 1985, 40: 515-526
52. Wnger R.H. et al, Anal. Biochem. 1994, 221: 416-418
53. Hamaguchi I. et al, J. Virol. 2000, 74: 10778-10784
54. Curradi M. et al, Mol. Cell. Biol. 2002, 22: 3157-3173
55. Rietveld L.E. et al, EMBO J. 2002, 21: 1389-1397
56. Gerolami R. et al, Cancer Gene Therapy 2000, 7: 1286-1292
PRODUCT NAME AND CATALOG NUMBER
(back to Table of Content)
Untagged Vectors
Epitope tagged Vectors
Gateway-adapted Destination Vectors
Kits
Untagged Vectors
(back to Table of Content)
(back to Product Name and Catalog Number)
Name Features Catalog Number
pcDNA3.1 (+) CMV promoter, Geneticin selection, CAT V790-20, V79020
expression control
pcDNA3.1 (-) CMV promoter, Geneticin selection, CAT V795-20, V79520
expression control
pcDNA3.1/Zeo (+) CMV promoter, Zeocin selection, CAT V860-20, V86020
expression control
pcDNA3.1/Zeo (-) CMV promoter, Zeocin selection, CAT V865-20, V86520
expression control
pcDNA3.1/Hygro (+) CMV promoter, Hygromycin selection, lacZ V870-20, V87020
expression control
pcDNA3.1/Hygro (-) CMV promoter, Hygromycin selection, lacZ V875-20, V87520
expression control
Epitope tagged Vectors
(back to Table of Content)
(back to Product Name and Catalog Number)
Name Features Catalog Number
pcDNA3.1/His A,B & C CMV promoter, N-term 6xHis- V385-20, V38520
Xpress, EK recognition site,
Geneticin selection, lacZ
expression control
pcDNA3.1/V5-His A, B & C CMV promoter, C-term V5-6xHis, V810-20, V81020
Geneticin selection, lacZ
expression control
Name Features Catalog Number
pcDNA3.1/myc-His A, B & C CMV promoter, C-term myc- V800-20, V80020
6xHis, Geneticin selection, lacZ
expression control
pcDNA3.1(-)/myc-His A, B & C CMV promoter, C-term myc- V855-20, V85520
6xHis, Geneticin selection, lacZ
expression control
pcDNA4/His A, B & C CMV promoter, N-term 6xHis- V862-20, V86220
Xpress, EK recognition site,
Zeocin selection, lacZ expression
control
pcDNA4/V5-His A, B & C CMV promoter, C-term V5-6xHis, V861-20, V86120
Zeocin selection, lacZ expression
control
pcDNA4/myc-His A, B & C CMV promoter, C-term myc- V863-20, V86320
6xHis, Zeocin selection, lacZ
expression control
pcDNA4/HisMax A, B & C CMV promoter, QBI SP163 V864-20, V86420
translational enhancer for maximal
protein expression, N-term 6xHis-
Xpress, EK recognition site,
Zeocin selection, lacZ expression
control
pcDNA6/His A, B & C CMV promoter, N-term 6xHis- V222-20, V22220
Xpress, EK recognition site,
Blasticidin selection, lacZ
expression control
pcDNA6/V5-His A, B & C CMV promoter, C-term V5-6xHis, V220-20, V22020
Blasticidin selection, lacZ
expression control
pcDNA6/V5-His A, B & C w/ CMV promoter, C-term V5-6xHis, V220-01, V22001
50 mg Blasticidin Blasticidin selection, lacZ
expression control, Blasticidin
pcDNA6/myc-His A, B & C CMV promoter, C-term myc- V221-20, V22120
6xHis, Blasticidin selection, lacZ
expression control
pEF1/His A, B & C EF1α promoter, N-terminal 6xHis- V922-20, V92220
Xpress, EK recognition site,
Geneticin selection, lacZ
expression control
pEF1/V5-His A, B & C EF1α promoter, C-term V5-6xHis, V920-20, V92020
Geneticin selection, lacZ
expression control
pEF1/myc-His A, B & C EF1α promoter, C-term myc- V921-20, V92120
6xHis, Geneticin selection, lacZ
expression control
pEF4/His A, B & C EF1α promoter, N-term 6xHis- V943-20, V94320
Xpress, EK recognition site,
Zeocin selection, lacZ expression
control
pEF4/V5-His A, B & C EF1α promoter, C-term V5-6xHis, V941-20, V94120
Zeocin selection, lacZ expression
control
Name Features Catalog Number
pEF4/myc-His A, B & C EF1α promoter, C-term myc- V942-20, V94220
6xHis, Zeocin selection, lacZ
expression control
pEF6/His A, B & C EF1α promoter, N-term 6xHis- V963-20, V96320
Xpress, EK recognition site,
Blasticidin selection, lacZ
expression control
pEF6/V5-His A, B & C EF1α promoter, C-term V5-6xHis, V961-20, V96120
Blasticidin selection, lacZ
expression control
pEF6/myc-His A, B & C EF1α promoter, C-term myc- V962-20, V96220
6xHis, Blasticidin selection, lacZ
expression control
pUB6/V5-His A, B & C Ubc promoter, C-term V5-6xHis, V250-20, V25020
Blasticidin selection, lacZ
expression control
pUB6/V5-His A, B & C w/ 50 Ubc promoter, C-term V5-6xHis, V250-01, V25001
mg Blasticidin Blasticidin selection, lacZ
expression control, Blasticidin
pBudCE4.1 For independent expression of two V532-20, V53220
genes, CMV promoter with C-term
myc-6xHis, EF-1α promoter with
C-term V5-6xHis, Zeocin
selection, lacZ/CAT expression
control
Gateway-adapted Destination Vectors
(back to Table of Content)
(back to Product Name and Catalog Number)
Name Features Catalog Number
pcDNA3.1/nV5-DEST Gateway attR sites, CMV promoter, N- 12290-010, 12290010
term V5, TEV recognition site, Geneticin
selection, lacZ expression control
pcDNA3.2/V5-DEST Gateway attR sites, CMV promoter, C- 12489-019, 12489019
term V5, Geneticin selection, CAT
expression control
pcDNA6.2/V5-DEST Gateway attR sites, CMV promoter, C- 12489-027, 12489027
term V5, Blasticidin selection, CAT
expression control
pDEST26 Gateway attR sites, CMV promoter, N- 11809-019, 11809019
term 6xHis, Geneticin selection
pDEST27 Gateway attR sites, CMV promoter, N- 11812-013, 11812013
term GST, Geneticin selection
pcDNA-DEST40 Gateway attR sites, CMV promoter, C- 12274-015, 12274015
term V5-6xHis, Geneticin selection, lacZ
expression control
pcDNA-DEST47 Gateway Vector Gateway attR sites, CMV promoter, C- 12281-010, 12281010
term Cycle 3 GFP, Geneticin selection,
CAT expression control
pcDNA-DEST53 Gateway Vector Gateway attR sites, CMV promoter, N- 12288-015, 12288015
term Cycle 3 GFP, Geneticin selection,
CAT expression control
Name Features Catalog Number
Vivid Colors pcDNA6.2/C-EmGFP- Gateway attR sites, CMV promoter, C- V355-20, V35520
DEST Gateway Vector term EmGFP, Blasticidin selection, CAT
expression control
Vivid Colors pcDNA6.2/N-EmGFP- Gateway attR sites, CMV promoter, N- V356-20, V35620
DEST Gateway Vector term EmGFP, Blasticidin selection, CAT
expression control
Vivid Colors pcDNA6.2/C-YFP-DEST Gateway attR sites, CMV promoter, C- V357-20, V35720
Gateway Vector term YFP, Blasticidin selection, CAT
expression control
Vivid Colors pcDNA6.2/N-YFP-DEST Gateway attR sites, CMV promoter, N- V358-20, V35820
Gateway Vector term YFP, Blasticidin selection, CAT
expression control
Vivid Colors pcDNA6.2/EmGFP- Gateway attR sites, CMV promoter, C- V366-20, V36620
Bsd/V5-DEST Mammalian Expression term V5, PGK promoter driving the
Vector Kit EmGFP-Blasticidin fusion gene, CAT
expression control
Kits
(back to Table of Content)
(back to Product Name and Catalog Number)
Name Features Catalog Number
pcDNA3.1/V5-His-TOPO TA TOPO TA cloning, CMV promoter, C-term V5- K4800-01, K480001,
Expression Kit 6xHis, Geneticin selection, lacZ expression K4800-40, K480040
control
pcDNA3.1Directional TOPO Directional TOPO cloning, CMV promoter, C- K4900-01, K490001,
Expression Kit termV5-6xHis, Geneticin selection, lacZ K4900-40, K490040
expression control
pcDNA4/HisMax TOPO TA TOPO TA cloning, CMV promoter, SP163 K864-20, K86420
Expression Kit translational enhancer, N-term 6xHis-Xpress,
EK recognition site, Zeocin selection, lacZ
expression control
pEF6/V5-His TOPO TA TOPO TA cloning, EF-1α promoter, C-term V5- K9610-20, K961020
Expression Kit 6xHis, Blasticidin selection, lacZ expression
control
pcDNA3.2/V5 Gateway Directional TOPO cloning, Gateway attB sites, K2440-20, K244020
Directional TOPO Expression CMV promoter, C-term V5, Geneticin selection,
Kit CAT expression control
pcDNA6.2/V5 Gateway Directional TOPO cloning, Gateway attB sites, K2460-20, K246020
Directional TOPO Expression CMV promoter, C-term V5, Blasticidin
Kit selection, CAT expression control
GeneBLAzer C-terminal TOPO Directional TOPO cloning, Gateway attB sites, 12578-076, 12578076
Fusion Kit for In Vitro Detection CMV promoter, C-term bla(M) (β-lactamase)
reporter gene, Blasticidin selection, lacZ
expression control, In Vitro detection kit
GeneBLAzer C-terminal TOPO Directional TOPO cloning, Gateway attB sites, 12578-084, 12578084
Fusion Kit for In Vivo Detection CMV promoter, C-term bla(M) (β-lactamase)
reporter gene, Blasticidin selection, lacZ
expression control, In Vivo detection kit
GeneBLAzer N-terminal TOPO Directional TOPO cloning, Gateway attB sites, 12578-092, 12578092
Fusion Kit for In Vitro Detection CMV promoter, N-term bla(M) (β-lactamase)
reporter gene, C-term V5, Blasticidin selection,
lacZ expression control, In Vitro detection kit
Name Features Catalog Number
GeneBLAzer N-terminal TOPO Directional TOPO cloning, Gateway attB sites, 12578-100, 12578100
Fusion Kit for In Vivo Detection CMV promoter, N-term bla(M) (β-lactamase)
reporter gene, C-term V5, Blasticidin selection,
lacZ expression control, In Vivo detection kit
GeneBLAzer C-terminal Gateway attB sites, CMV promoter, C-term 12578-035,
Gateway Fusion Kit for In Vitro bla(M) (β-lactamase) reporter gene, Blasticidin 12578035
Detection selection, lacZ expression control, In Vitro
detection kit
GeneBLAzer C-terminal Gateway attB sites, CMV promoter, C-term 12578-043,
Gateway Fusion Kit for In Vivo bla(M) (β-lactamase) reporter gene, Blasticidin 12578043
Detection selection, lacZ expression control, In Vivo
detection kit
GeneBLAzer N-terminal Gateway attB sites, CMV promoter, N-term 12578-050,
Gateway Fusion Kit for In Vitro bla(M) (β-lactamase) reporter gene, C-term V5, 12578050
Detection Blasticidin selection, lacZ expression control, In
Vitro detection kit
GeneBLAzer N-terminal Gateway attB sites, CMV promoter, N-term 12578-068,
Gateway Fusion Kit for In Vivo bla(M) (β-lactamase) reporter gene, C-term V5, 12578068
Detection Blasticidin selection, lacZ expression control, In
Vivo detection kit
pGeneBLAzer TOPO TA TOPO TA cloning, No promoter, C-term bla(M) 12578-019,
Expression Kit for In Vitro (β-lactamase) reporter gene, Geneticin selection, 12578019
Detection expression control with Ubc promoter upstream
of bla(M) reporter gene, In Vitro detection kit
pGeneBLAzer TOPO TA TOPO TA cloning, No promoter, C-term bla(M) 12578-027,
Expression Kit for In Vivo (β-lactamase) reporter gene, Geneticin selection, 12578027
Detection expression control with Ubc promoter upstream
of bla(M) reporter gene, In Vivo detection kit
Mammalian Lumio Gateway Gateway attR sites, CMV promoter, Choice of 12589-016,
Vectors with Lumio Green In- C-term or N-term Lumio and V5 tags, 12589016
Cell Detection Kit Blasticidin selection, p64 expression control,
Lumio Green In-Cell detection kit
Mammalian Lumio Gateway Gateway attR sites, CMV promoter, Choice of 12589-024,
Vectors with Lumio Red In-Cell C-term or N-term Lumio and V5 tags, 12589024
Detection Kit Blasticidin selection, p64 expression control,
Lumio Red In-Cell detection kit
Mammalian Lumio Gateway Gateway attR sites, CMV promoter, Choice of 12589-032,
Vectors with Dual Lumio Red C-term or N-term Lumio and V5 tags, 12589032
and Green In-Cell Detection Kit Blasticidin selection, p64 expression control,
Lumio Green In-Cell detection kit, Lumio Red
In-Cell detection kit
NT-GFP Fusion TOPO TA TOPO TA cloning, CMV promoter, N-term K4810-01, K481001
Expression Kit Cycle 3 GFP, Geneticin selection, N-term GFP
expression control
CT-GFP Fusion TOPO TA TOPO TA cloning, CMV promoter, C-term K4820-01, K482001
Expression Kit Cycle 3 GFP, Geneticin selection, C-term GFP
expression control
Vivid Colors pcDNA6.2/C- TOPO TA cloning, Gateway attB sites, CMV K359-20, K35920
EmGFP-GW/TOPO Mammalian promoter, C-term EmGFP, Blasticidin selection,
Expression Vector Kit CAT expression control
Vivid Colors pcDNA6.2/N- TOPO TA cloning, Gateway attB sites, CMV K360-20, K36020
EmGFP-GW/TOPO Mammalian promoter, N-term EmGFP, C-term V5,
Expression Vector Kit Blasticidin selection, CAT expression control
Name Features Catalog Number
Vivid Colors pcDNA6.2/C-YFP- TOPO TA cloning, Gateway attB sites, CMV K361-20, K36120
GW/TOPO Mammalian promoter, C-term YFP, Blasticidin selection,
Expression Vector Kit CAT expression control
Vivid Colors pcDNA6.2/N-YFP- TOPO TA cloning, Gateway attB sites, CMV K362-20, K36220
GW/TOPO Mammalian promoter, N-term YFP, C-term V5, Blasticidin
Expression Vector Kit selection, CAT expression control
pcDNA6/BioEase Gateway Gateway attR sites, CMV promoter, N-term K980-01, K98001
Biotinylation System BioEase tag, EK recognition site, Blasticidin
selection, lacZ expression control
pZeoSV2 (+) Vector Kit SV40 promoter, Zeocin selection, lacZ V850-01, V85001
expression control, Zeocin
pZeoSV2 (-) Vector Kit SV40 promoter, Zeocin selection, lacZ V855-01, V85501
expression control, Zeocin
COMPONENTS
(back to Table of Content)
Untagged Vectors
Epitope tagged Vectors
Gateway-adapted Destination Vectors
Kits
Untagged Vectors
(back to Table of Content)
(back to Product Name and Catalog Number)
Name Part Number Catalog Number Components
pcDNA3.1 (+) 430018 V790-20, V79020 20 µg pcDNA3.1 (+),
lyophilized in TE, pH 8.0
20 µg pcDNA3.1/CAT,
lyophilized in TE, pH 8.0
pcDNA3.1 (-) 430019 V795-20, V79520 20 µg pcDNA3.1 (-),
lyophilized in TE, pH 8.0
20 µg pcDNA3.1/CAT,
lyophilized in TE, pH 8.0
pcDNA3.1/Zeo (+) 430020 V860-20, V86020 20 µg pcDNA3.1/Zeo (+),
lyophilized in TE, pH 8.0
20 µg pcDNA3.1/Zeo/CAT,
lyophilized in TE, pH 8.0
pcDNA3.1/Zeo (-) 430021 V865-20, V86520 20 µg pcDNA3.1/Zeo (-),
lyophilized in TE, pH 8.0
20 µg pcDNA3.1/Zeo/CAT,
lyophilized in TE, pH 8.0
Name Part Number Catalog Number Components
pcDNA3.1/Hygro (+) 430039 V870-20, V87020 20 ug pcDNA3.1/Hygro (+),
lyophilized in TE, pH 8.0
20 ug pcDNA3.1/Hygro/lacZ,
lyophilized in TE, pH 8.0
pcDNA3.1/Hygro (-) 430038 V875-20, V87520 20 ug pcDNA3.1/Hygro (-),
lyophilized in TE, pH 8.0
20 ug pcDNA3.1/Hygro/lacZ,
lyophilized in TE, pH 8.0
Epitope tagged Vectors
(back to Table of Content)
(back to Product Name and Catalog Number)
Name Part Number Catalog Number Components
pcDNA3.1/His A,B & C 430028 V385-20, V38520 20 ug each pcDNA3.1/His A, B & C,
lyophilized in TE, pH 8.0
20 ug pcDNA3.1/His/lacZ, lyophilized in
TE, pH 8.0
pcDNA3.1/V5-His A, B & C 430037 V810-20, V81020 20 ug each pcDNA3.1/V5-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pcDNA3.1/V5-His/lacZ, lyophilized
in TE, pH 8.0
pcDNA3.1/myc-His A, B & C 430036 V800-20, V80020 20 ug each pcDNA3.1/myc-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pcDNA3.1/myc-His/lacZ, lyophilized
in TE, pH 8.0
pcDNA3.1(-)/myc-His A, B & C 430029 V855-20, V85520 20 ug each pcDNA3.1(-)/myc-His A, B &
C, lyophilized in TE, pH 8.0
20 ug pcDNA3.1/myc-His/lacZ, lyophilized
in TE, pH 8.0
pcDNA4/His A, B & C 430005 V862-20, V86220 20 ug each pcDNA4/His A, B & C,
lyophilized in TE, pH 8.0
20 ug pcDNA4/His/lacZ, lyophilized in TE,
pH 8.0
pcDNA4/V5-His A, B & C 430004 V861-20, V86120 20 ug each pcDNA4/V5-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pcDNA4/V5-His/lacZ, lyophilized in
TE, pH 8.0
pcDNA4/myc-His A, B & C 430011 V863-20, V86320 20 ug each pcDNA4/myc-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pcDNA4/myc-His/lacZ, lyophilized
in TE, pH 8.0
pcDNA4/HisMax A, B & C 430078 V864-20, V86420 20 ug each pcDNA4/HisMax A, B & C,
lyophilized in TE, pH 8.0
Name Part Number Catalog Number Components
20 ug pcDNA4/HisMax/lacZ, lyophilized in
TE, pH 8.0
pcDNA6/His A, B & C 430030 V222-20, V22220 20 ug each pcDNA6/His A, B & C,
lyophilized in TE, pH 8.0
20 ug pcDNA6/His/lacZ, lyophilized in TE,
pH 8.0
pcDNA6/V5-His A, B & C 430003 V220-20, V22020 20 ug each pcDNA6/V5-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pcDNA6/V5-His/lacZ, lyophilized in
TE, pH 8.0
pcDNA6/V5-His A, B & C w/ 430003 V220-01, V22001 20 ug each pcDNA6/V5-His A, B & C,
50 mg Blasticidin 461120 lyophilized in TE, pH 8.0
20 ug pcDNA6/V5-His/lacZ, lyophilized in
TE, pH 8.0
50 mg Blasticidin, white powder
pcDNA6/myc-His A, B & C 430070 V221-20, V22120 20 ug each pcDNA4/myc-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pcDNA4/myc-His/lacZ, lyophilized
in TE, pH 8.0
pEF1/His A, B & C 430073 V922-20, V92220 20 ug each pEF1/His A, B & C, lyophilized
in TE, pH 8.0
20 ug pEF1/His/lacZ, lyophilized in TE, pH
8.0
pEF1/V5-His A, B & C 430067 V920-20, V92020 20 ug each pEF1/V5-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pEF1/V5-His/lacZ, lyophilized in TE,
pH 8.0
pEF1/myc-His A, B & C 430006 V921-20, V92120 20 ug each pEF1/myc-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pEF1/myc-His/lacZ, lyophilized in
TE, pH 8.0
pEF4/His A, B & C 430009 V943-20, V94320 20 ug each pEF4/His A, B & C, lyophilized
in TE, pH 8.0
20 ug pEF4/His/lacZ, lyophilized in TE, pH
8.0
pEF4/V5-His A, B & C 430008 V941-20, V94120 20 ug each pEF4/V5-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pEF4/V5-His/lacZ, lyophilized in TE,
pH 8.0
pEF4/myc-His A, B & C 430069 V942-20, V94220 20 ug each pEF4/myc-His A, B & C,
lyophilized in TE, pH 8.0
Name Part Number Catalog Number Components
20 ug pEF4/myc-His/lacZ, lyophilized in
TE, pH 8.0
pEF6/His A, B & C 430071 V963-20, V96320 20 ug each pEF6/His A, B & C, lyophilized
in TE, pH 8.0
20 ug pEF6/His/lacZ, lyophilized in TE, pH
8.0
pEF6/V5-His A, B & C 430007 V961-20, V96120 20 ug each pEF6/V5-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pEF6/V5-His/lacZ, lyophilized in TE,
pH 8.0
pEF6/myc-His A, B & C 430075 V962-20, V96220 20 ug each pEF6/myc-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pEF6/myc-His/lacZ, lyophilized in
TE, pH 8.0
pUB6/V5-His A, B & C 430072 V250-20, V25020 20 ug each pUB6/V5-His A, B & C,
lyophilized in TE, pH 8.0
20 ug pUB6/V5-His/lacZ, lyophilized in
TE, pH 8.0
pUB6/V5-His A, B & C w/ 430072 V250-01, V25001 20 ug each pUB6/V5-His A, B & C,
50 mg Blasticidin 461120 lyophilized in TE, pH 8.0
20 ug pUB6/V5-His/lacZ, lyophilized in
TE, pH 8.0
50 mg Blasticidin, white powder
pBUDCE4.1 430100 V532-20, V53220 20 ug pBUDCE4.1, lyophilized in TE, pH
8.0
20 ug pBUDCE4.1/lacZ/CAT, lyophilized
in TE, pH 8.0
Gateway-adapted Destination Vectors
(back to Table of Content)
(back to Product Name and Catalog Number)
Name Part Number Catalog Number Components
pcDNA3.1/nV5-DEST 430114 12290-010, 12290010 6 ug pcDNA3.1/nV5-DEST,
lyophilized in TE, pH 8.0
10 ug pcDNA3.1/nV5-GW/lacZ,
lyophilized in TE, pH 8.0
pcDNA3.2/V5-DEST 430115 12489-019, 12489019 6 ug pcDNA3.2/V5-DEST,
lyophilized in TE, pH 8.0
10 ug pcDNA3.2/V5/GW/CAT,
lyophilized in TE, pH 8.0
pcDNA6.2/V5-DEST 430116 12489-027, 12489027 6 ug pcDNA6.2/V5-DEST,
lyophilized in TE, pH 8.0
Name Part Number Catalog Number Components
10 ug pcDNA6.2/V5/GW/CAT,
lyophilized in TE, pH 8.0
pDEST26 430228 11809-019, 11809019 6 ug pDEST26, lyophilized in TE,
pH 8.0
pDEST27 430229 11812-013, 11812013 6 ug pDEST27, lyophilized in TE,
pH 8.0
pcDNA-DEST40 430101 12274-015, 12274015 6 ug pcDNA-DEST40, lyophilized
in TE, pH 8.0
10 ug pcDNA/GW-40/lacZ,
lyophilized in TE, pH 8.0
pcDNA-DEST47 Gateway 430102 12281-010, 12281010 6 ug pcDNA-DEST47, lyophilized
Vector in TE, pH 8.0
10 ug pcDNA/GW-47/CAT,
lyophilized in TE, pH 8.0
pcDNA-DEST53 Gateway 430107 12288-015, 12288015 6 ug pcDNA-DEST53, lyophilized
Vector in TE, pH 8.0
10 ug pcDNA/GW-53/CAT,
lyophilized in TE, pH 8.0
Vivid Colors pcDNA6.2/C- 431900 V355-20, V35520 6 ug pcDNA6.2/C-EmGFP-DEST,
EmGFP-DEST Gateway lyophilized in TE, pH 8.0
Vector
10 ug pcDNA6.2/C-
EmGFP/GW/CAT, lyophilized in
TE, pH 8.0
Vivid Colors pcDNA6.2/N- 431901 V356-20, V35620 6 ug pcDNA6.2/N-EmGFP-DEST,
EmGFP-DEST Gateway lyophilized in TE, pH 8.0
Vector
10 ug pcDNA6.2/N-
EmGFP/GW/CAT, lyophilized in
TE, pH 8.0
Vivid Colors pcDNA6.2/C- 431902 V357-20, V35720 6 ug pcDNA6.2/C-YFP-DEST,
YFP-DEST Gateway Vector lyophilized in TE, pH 8.0
10 ug pcDNA6.2/C-
YFP/GW/CAT, lyophilized in TE,
pH 8.0
Vivid Colors pcDNA6.2/N- 431903 V358-20, V35820 6 ug pcDNA6.2/N-YFP-DEST,
YFP-DEST Gateway Vector lyophilized in TE, pH 8.0
10 ug pcDNA6.2/N-
YFP/GW/CAT, lyophilized in TE,
pH 8.0
Vivid Colors 431908 V366-20, V36620 6 ug pcDNA6.2/EmGFP-Bsd/V5-
pcDNA6.2/EmGFP-Bsd/V5- DEST Gateway vector, lyophilized
DEST Mammalian in TE, pH 8.0
Expression Vector Kit
10 ug pcDNA6.2/EmGFP-Bsd/V5-
GW/CAT control vector,
lyophilized in TE, pH 8.0
Kits
(back to Table of Content)
(back to Product Name and Catalog Number)
pcDNA3.1/V5-His-TOPO TA Expression Kit
Components Part Number Catalog Number Size
pcDNA3.1/V5-His TOPO 450005 K4800-01, K480001 20 reactions
TA cloning kit K4800-40, K480040 40 reactions
One Shot TOP10 440301
chemically competent E.coli
pcDNA3.1Directional TOPO Expression Kit
Components Part Number Catalog Number Size
pcDNA3.1D/V5-His- TOPO 450158 K4900-01, K490001 20 reactions
cloning kit K4900-40, K490040 40 reactions
One Shot TOP10 440301
chemically competent E.coli
pcDNA4/HisMax TOPO TA Expression Kit
Components Part Number Catalog Number Size
pcDNA4/HisMax TOPO 450067 K864-20, K86420 20 reactions
TA cloning kit
One Shot TOP10 440301
chemically competent E.coli
pEF6/V5-His TOPO TA Expression Kit
Components Part Number Catalog Number Size
pEF6/V5-His TOPO TA 450051 K9610-20, K961020 20 reactions
cloning kit
One Shot TOP10 440301
chemically competent E.coli
pcDNA3.2/V5 Gateway Directional TOPO Expression Kit
Components Part Number Catalog Number Size
pcDNA3.2/V5/GW/D-TOPO 450224 K2440-20, K244020 20 reactions
cloning kit
One Shot TOP10 chemically 440301
competent E.coli
pcDNA6.2/V5 Gateway Directional TOPO Expression Kit
Components Part Number Catalog Number Size
pcDNA6.2/V5/GW/D-TOPO 450225 K2460-20, K246020 20 reactions
cloning kit
One Shot TOP10 chemically 440301
competent E.coli
GeneBLAzer C-terminal TOPO Fusion Kit for In Vitro Detection
Components Part Number Catalog Number Size
pcDNA6.2/cGeneBLAzer- 450254 12578-076, 12578076 20 reactions
GW/D-TOPO cloning kit
One Shot Mach1-T1 phage C8620-03,
resistant chemically C862003
competent E.coli
GeneBLAzer In Vitro 457504
Detection kit
GeneBLAzer C-terminal TOPO Fusion Kit for In Vivo Detection
Components Part Number Catalog Number Size
pcDNA6.2/cGeneBLAzer- 450254 12578-084, 12578084 20 reactions
GW/D-TOPO cloning kit
One Shot Mach1-T1 phage C8620-03,
resistant chemically C862003
competent E.coli
GeneBLAzer In Vivo 457500 &
Detection kit 457502
GeneBLAzer N-terminal TOPO Fusion Kit for In Vitro Detection
Components Part Number Catalog Number Size
pcDNA6.2/nGeneBLAzer- 450255 12578-092, 12578092 20 reactions
GW/D-TOPO cloning kit
One Shot Mach1-T1 phage C8620-03,
resistant chemically C862003
competent E.coli
GeneBLAzer In Vitro 457504
Detection kit
GeneBLAzer N-terminal TOPO Fusion Kit for In Vivo Detection
Components Part Number Catalog Number Size
pcDNA6.2/nGeneBLAzer- 450255 12578-100, 12578100 20 reactions
GW/D-TOPO cloning kit
One Shot Mach1-T1 phage C8620-03,
resistant chemically C862003
competent E.coli
GeneBLAzer In Vivo 457500 &
Detection kit 457502
GeneBLAzer C-terminal Gateway Fusion kit for In Vitro Detection
Components Part Number Catalog Number Amount
pcDNA6.2/cGeneBLAzer- 430940 12578-035, 12578035 6 ug pcDNA6.2/cGeneBLAzer-DEST,
DEST lyophilized in TE, pH 8.0
10 ug pcDNA6.2/cGeneBLAzer-
GW/lacZ, lyophilized in TE, pH 8.0
GeneBLAzer In Vitro 457504
Detection kit
GeneBLAzer C-terminal Gateway Fusion kit for In Vivo Detection
Components Part Number Catalog Number Amount
pcDNA6.2/cGeneBLAzer- 430940 12578-043, 12578043 6 ug pcDNA6.2/cGeneBLAzer-DEST,
DEST lyophilized in TE, pH 8.0
10 ug pcDNA6.2/cGeneBLAzer-
GW/lacZ, lyophilized in TE, pH 8.0
GeneBLAzer In Vivo 457500 &
Detection kit 457502
GeneBLAzer N-terminal Gateway Fusion kit for In Vitro Detection
Components Part Number Catalog Number Amount
pcDNA6.2/nGeneBLAzer- 430941 12578-050, 12578050 6 ug pcDNA6.2/nGeneBLAzer-DEST,
DEST lyophilized in TE, pH 8.0
10 ug pcDNA6.2/nGeneBLAzer-
GW/lacZ, lyophilized in TE, pH 8.0
GeneBLAzer In Vitro 457504
Detection kit
GeneBLAzer N-terminal Gateway Fusion kit for In Vivo Detection
Components Part Number Catalog Number Amount
pcDNA6.2/nGeneBLAzer- 430941 12578-068, 12578068 6 ug pcDNA6.2/nGeneBLAzer-DEST,
DEST lyophilized in TE, pH 8.0
10 ug pcDNA6.2/nGeneBLAzer-
GW/lacZ, lyophilized in TE, pH 8.0
GeneBLAzer In Vivo 457500 &
Detection kit 457502
pGeneBLAzer TOPO TA Expression Kit for In Vitro Detection
Components Part Number Catalog Number Size
pGeneBLAzer TOPO TA 450504 12578-019, 12578019 20 reactions
cloning kit
One shot TOP10 chemically 440301
competent E.coli
GeneBLAzer In Vitro 457504
Detection kit
pGeneBLAzer TOPO TA Expression Kit for In Vivo Detection
Components Part Number Catalog Number Size
pGeneBLAzer TOPO TA 450504 12578-027, 12578027 20 reactions
cloning kit
One shot TOP10 chemically 440301
competent E.coli
GeneBLAzer In Vivo 457500 &
Detection kit 457502
Mammalian Lumio Gateway Vectors with Lumio Green In-Cell Detection Kit
Components Part Number Catalog Number Amount
Mammalian Lumio Gateway Vectors 430950 12589-016, 12589016 6 ug pcDNA6.2/cLumio-DEST,
lyophilized in TE, pH 8.0
6 ug pcDNA6.2/nLumio-DEST,
lyophilized in TE, pH 8.0
10 ug pcDNA6.2/nLumio-GW/p64,
lyophilized in TE, pH 8.0
Lumio Green In-Cell Detection kit 457510
Mammalian Lumio Gateway Vectors with Lumio Red In-Cell Detection Kit
Components Part Number Catalog Number Amount
Mammalian Lumio Gateway Vectors 430950 12589-024, 12589024 6 ug pcDNA6.2/cLumio-DEST,
lyophilized in TE, pH 8.0
6 ug pcDNA6.2/nLumio-DEST,
lyophilized in TE, pH 8.0
10 ug pcDNA6.2/nLumio-GW/p64,
lyophilized in TE, pH 8.0
Lumio Red In-Cell Detection kit 457512
Mammalian Lumio Gateway Vectors with Dual Lumio Red and Green In-Cell Detection Kit
Components Part Number Catalog Number Amount
Mammalian Lumio Gateway Vectors 430950 12589-032, 12589032 6 ug pcDNA6.2/cLumio-DEST,
lyophilized in TE, pH 8.0
6 ug pcDNA6.2/nLumio-DEST,
lyophilized in TE, pH 8.0
10 ug pcDNA6.2/nLumio-GW/p64,
lyophilized in TE, pH 8.0
Lumio Green In-Cell Detection kit 457510
Lumio Red In-Cell Detection kit 457512
NT-GFP Fusion TOPO TA Expression Kit
Components Part Number Catalog Number Size
pcDNA3.1/NT-GFP-TOPO 450247 K4810-01, K481001 20 reactions
TA cloning kit
One Shot TOP10 chemically 440301
competent E.coli
CT-GFP Fusion TOPO TA Expression Kit
Components Part Number Catalog Number Size
pcDNA3.1/CT-GFP-TOPO 450246 K4820-01, K482001 20 reactions
TA cloning kit
One Shot TOP10 chemically 440301
competent E.coli
Vivid Colors pcDNA6.2/C-EmGFP-GW/TOPO Mammalian Expression Vector Kit
Components Part Number Catalog Number Size
pcDNA6.2/C-EmGFP- 451900 K359-20, K35920 20 reactions
GW/TOPO cloning kit
One Shot TOP10 440301
chemically competent
E.coli
Vivid Colors pcDNA6.2/N-EmGFP-GW/TOPO Mammalian Expression Vector Kit
Components Part Number Catalog Number Size
pcDNA6.2/N-EmGFP- 451901 K360-20, K36020 20 reactions
GW/TOPO cloning kit
One Shot TOP10 440301
chemically competent
E.coli
Vivid Colors pcDNA6.2/C-YFP-GW/TOPO Mammalian Expression Vector Kit
Components Part Number Catalog Number Size
pcDNA6.2/C-YFP- 451902 K361-20, K36120 20 reactions
GW/TOPO cloning kit
One Shot TOP10 440301
chemically competent
E.coli
Vivid Colors pcDNA6.2/N-YFP-GW/TOPO Mammalian Expression Vector Kit
Components Part Number Catalog Number Size
pcDNA6.2/N-YFP- 451903 K362-20, K36220 20 reactions
GW/TOPO cloning kit
One Shot TOP10 440301
chemically competent
E.coli
pcDNA6/BioEase Gateway Biotinylation System
Components Part Number Catalog Number Amount
BioEase Gateway Vectors 430111 K980-01, K98001 6 ug pcDNA6/BioEase-DEST,
lyophilized in TE, pH 8.0
10 ug pcDNA6/BioEase-GW/lacZ,
lyophilized in TE, pH 8.0
Streptavidin-HRP Conjugate 19534050 50 ul supplied in MOPS buffer (refer
to label on tube for concentration)
pZeoSV2 (+) Vector Kit
Components Part Number Catalog Number Amount
pZeoSV2 (+) 350566 V850-01, V85001 20 ug pZeoSV2 (+),
lyophilized in TE, pH 8.0
pZeoSV2 kit 450451 20 ug pZeoSV2/lacZ,
lyophilized in TE, pH 8.0
Zeocin, 3 X 1.25 ml,
100mg/ml in sterile deionized
water
pZeoSV2 (-) Vector Kit
Components Part Number Catalog Number Amount
pZeoSV2 (-) 350570 V855-01, V85501 20 ug pZeoSV2 (-),
lyophilized in TE, pH 8.0
pZeoSV2 kit 450451 20 ug pZeoSV2/lacZ,
lyophilized in TE, pH 8.0
Zeocin, 3 X 1.25 ml,
100mg/ml in sterile deionized
water
Need more help? Please email us by clicking here
|