We want to
hear from you!
Tip:
Click here
1. To search the note, press CTRL-F keys in combination
2. To navigate the note, use the links.
MultiSite Gateway庐 Cloning Technology
TABLE OF CONTENTS
PRODUCT DESCRIPTION
SHIPPING CONDITIONS
STORAGE CONDITIONS
STABILITY
QC SPECIFICATIONS
PROTOCOL & APPLICATION NOTES
Donor Vectors
The attB3 and attB4 sites
Designing att B sequences for PCR
Size Restriction for Multi-site Gateway cloning
BP Clonase reaction
LR Clonase reaction
Sequencing Primers
ALTERNATE PRODUCTS & COMPATIBILITY
PRODUCT DOCUMENTATION
REFERENCES
PRODUCT NAME & CATALOG NUMBER
COMPONENTS
ASSOCIATED PRODUCTS
1
PRODUCT DESCRIPTION
(back to Table of Contents)
MultiSite Gateway is an extension of the Gateway site-specific recombinational cloning system. This technology makes complex
cloning schemes simpler and more efficient. As in the present version of Gateway, to enter MultiSite Gateway, sets of Entry
Clones are obtained or generated. Entry Clones are mixed together with the appropriate MultiSite Gateway Destination Vector in
a single LR reaction that results in the simultaneous cloning of multiple fragments into the Destination Vector backbone. The
cloning schemes include but are not limited to; mixing and matching of promoters and ORFs to study differential gene expression,
promoter investigations, evaluate several different promoters and purification tags (individually and in combination) to optimize
protein expression and purification, and protein domain swapping.
In the MultiSite Gateway Three Fragment Vector construction kit, two new attB sites are introduced into the current set of attB
sequences. These new attB sites, like the attB1 and attB2 sites create sequence specific recombination groups that do not
recombine with non-like sequences, thereby conferring directionality of cloning in standard Gateway cloning. This kit allows 5鈥?
and 3鈥? elements that are supplied as Entry clones to be linked and assembled on the destination vector pDESTR4R3 in a single LR
reaction.
The ViraPower Promoterless Lentiviral Gateway Expression System combines Invitrogen鈥檚 ViraPower Lentiviral and MultiSite
Gateway technologies to facilitate lentiviral-based expression of a gene of interest from any promoter of choice in dividing or non-
dividing mammalian cells. The System includes the pENTR5鈥?-TOPO vector for production of an entry clone containing the
eukaryotic promoter of interest and the promoterless pLenti6/R4R2/V5-DEST destination vector into which the promoter and gene
of interest are transferred.
The pENTR5鈥?-TOPO vector is TOPO-adapted and MultiSite Gateway-adapted to allow TOPO Cloning of a Taq polymerase-
amplified PCR product encoding the promoter of interest and easy transfer of the promoter sequence into the pLenti6/R4R2/V5-
DEST vector, respectively.
SHIPPING CONDITIONS
(back to Table of Contents)
The kits are shipped on dry ice.
STORAGE CONDITIONS
(back to Table of Contents)
Store vectors at 鈥?20oC, Enzyme mixes, and Competent E. coli at 鈥?80oC. BP Clonase II and LR Clonase II enzyme mixes can be
stored at -20C.
STABILITY
(back to Table of Contents)
All reagents are guaranteed stable for 6 months when properly stored.
QC SPECIFICATIONS
(back to Table of Contents)
Details on QC specifications can be found in the respective manuals.
PROTOCOL AND APPLICATION NOTES
(back to Table of Contents)
Donor Vectors
The attB3 and attB4 sites
Designing att B sequences for PCR
Size Restriction for Multi-site Gateway cloning
BP Clonase reaction
2
LR Clonase reaction
Sequencing Primers
Donor vectors
(back to Table of Contents)
(back to Protocol and Application Notes)
The pDONRP4-P1R and pDONRP2R-P3 are derived from pDONR221.
When cloning of promoters or other DNA fragments with repeat sequences into pDONRP4P1R, there is a possibility of
the promoter deleting or recombining out when the resulting Entry clone is propagated for a maxi prep. This could be due
to a combination of toxic/unstable insert and recombination between attB4, and attB1. This results in the deletion of the
ccdB gene due to recombination between attB4 and attB1. Here are some suggestions that may help:
Transform Stbl2 or Stbl3 cells with the cloning reaction.
After transformation grow plates at 30oC (for both Stbl2, Stbl3 as well as TOP10 cells). Screen 20-30 colonies.
Expect low cloning efficiency.
Once the Entry clones are obtained, isolate mini-prep DNA and use that DNA for the MultiSite assembly
reaction. The gene may become stabilized once in an expression clone.
In cases of problems with getting the PCR product to recombine into the Donor vectors, the PCR product can first be cloned into a
TOPO TA or TA cloning vector. After selecting the correct clone, linearize the DNA and perform a BP recombination reaction
with the Donor vector.
The attB3 and attB4 sites
(back to Table of Contents)
(back to Protocol and Application Notes)
In the MultiSite Three-Fragment Cloning kit, two new attB sites were introduced into the Donor vectors.
attB3: 5鈥? CAACTTTGTATAATAAAGTTG 3鈥?
attB4: 5鈥? CAACTTTGTATAGAAAAGTTG 3鈥?
These new attB sites, like the attB1 and attB2 sites create sequence specific recombination groups that do not recombine with non-
like sequences. This sequence specific recombination property of the attB sites confers directionality of cloning in standard
Gateway cloning and directs the accurate assembly of multiple fragments when cloning with MultiSite Gateway.
Designing att B sequences for PCR
(back to Table of Contents)
(back to Protocol and Application Notes)
To generate PCR products that will recombine with pDONRP4-P1R to generate pENTR5鈥? clones the following sequences need to
be added to the 5鈥? end of the Forward and Reverse PCR primers.
att B4: 5鈥? GGGGCAACTTTGTATAGAAAAGTTG 3鈥?(added to the 5鈥? PCR primer)
att B1: 5鈥? GGGGCTGCTTTTTTGTACAAACTTG 3鈥?(added to the 3鈥? PCR primer)
To generate PCR products that will recombine with pDONRP2R-P3 to generate pENTR3鈥? clones the following sequences need to
be added to the 5鈥? end of Forward and Reverse PCR primers.
att B2: 5鈥? GGGGCAGCTTTCTTGTACAAAGTGG 3鈥?(added to the 5鈥? PCR primer)
att B3: 5鈥? GGGGCAACTTTGTATAATAAAGTTG 3鈥?(added to the 3鈥? PCR primer)
Size Restriction for Multi-site Gateway cloning
(back to Table of Contents)
(back to Protocol and Application Notes)
The 1-2 kb fragments have been successfully cloned into each of the donor vectors. However there is no size limitation in a
typical Gateway recombination reaction. For example, it is possible to recombine the adenoviral vector (~33 kb) with an entry
clone. Overall, the total size for all vectors and inserts in Gateway recombination can be upwards of 35-40 kb. In MultiSite
Gateway cloning, it is recommended to do an overnight reaction with LR Clonase Plus Enzyme Mix in order to increase the
3
efficiency of recombination. The number of colonies, with larger fragments, may drop off substantially, but the percent efficiency
is around 90-95%.
BP Clonase reaction
(back to Table of Contents)
(back to Protocol and Application Notes)
Recombination reactions to generate Entry clones with PCR product and either pDONRP4-P1R or pDONRP2R-P3 are carried out
in a standard BP Clonase reaction.
LR Clonase reaction
(back to Table of Contents)
(back to Protocol and Application Notes)
The difference between a standard LR reaction and a MultiSite LR reaction is the use of the 5X LR Clonase Plus reaction buffer in
place of the standard 5X LR reaction buffer. This LR Clonase Plus reaction buffer is required for MultiSite Gateway reactions due
to the lowered number of colonies generated when performing these reactions with the standard 5X LR reaction buffer. MultiSite
Gateway reactions performed with the standard LR reaction buffer is only, at best, 4% as efficient as the LR Clonase Plus reaction
buffer.
Sequencing Primers for inserts cloned into pENTR5鈥?-TOPO
(back to Table of Contents)
(back to Protocol and Application Notes)
For sequencing from within an attR1 region the GW3 priming site can be used. The primer sequence is 5鈥?-TTA ATA
TAT TGA TAT TTA TAT CAT TTT ACG-3鈥?
For sequencing from within an attL4 region the modified GW1 primer can be used. The primer sequence is 5鈥?-GTT GCA
ACA AAT TGA TAA GCA ATG C-3鈥?
PRODUCT DOCUMENTATION
(back to Table of Contents)
Brochures Citations Cell lines
COA FAQ Licensing
Manuals MSDS Newsletters
Vector Data
REFERENCES
(back to Table of Contents)
1. Cheo DL, Titus SA, Byrd DRN, Hartley JL, Temple GF, and Brasch MA. Concerted Assembly and Cloning of Multiple
DNA Segments Using In Vitro Site-Specific Recombination: Functional Analysis of Multi-Segment Expression Clones.
Genome Res., 2004 Oct; 14: 2111-2120.
2. Cooke BM and Coppel RL. Blue skies or stormy weather: what lies ahead for malaria research? Trends in Parasitology,
2004 Dec;20(12):611-4.
3. Hare EE, and Loer CM. Function and evolution of the serotonin-synthetic bas-1 gene and other aromatic amino acid
decarboxylase genes in Caenorhabditis. BMC Evolutionary Biology 2004, 4:24.
4. Hope IA, Stevens J, Garner A, Hayes J, Cheo DL, Brasch MA, and Vidal M. Feasibility of Genome-Scale Construction of
Promoter::Reporter Gene Fusions for Expression in Caenorhabditis elegans Using a MultiSite Gateway Recombination
System. Genome Res., 2004 Oct; 14: 2070 - 2075.
5. Phan J, Tropea JE and Waugh DS. Structure of the Yersinia pestis type III secretion chaperone SycH in complex with a
stable fragment of YscM2. Acta Cryst (2004). D60, 1591-1599.
4
6. Sasaki Y, Sone T, Yoshida S, Yahata K, Hotta J, Chesnut JD, Honda T and Imamoto F. Evidence for high specificity and
efficiency of multiple recombination signals in mixed DNA cloning by the Multisite Gateway system. Journal of
Biotechnology, 2004 Feb; 107(3): 233-243.
7. Schubot FD, Jackson MW, Penrose KJ, Cherry S, Tropea JE, Plano GV and Waugh DS. Three-dimensional Structure of a
Macromolecular Assembly that Regulates Type III Secretion in Yersinia pestis. Journal of Molecular Biology, 2005
March; 346(4): 1147-1161.
8. Wakabayashi T, Kitagawa I and Shingai R. Neurons regulating the duration of forward locomotion in Caenorhabditis
elegans. Neuroscience Research, 2004 Sep; 50(1): 103-11.
PRODUCT NAME AND CATALOG NUMBERS
(back to Table of Contents)
Name Size Part Number Catalog Number
MultiSite Gateway Three- Fragment Vector 20 reactions N/A 12537023
Construction Kit
ViraPower Promoterless Lentiviral Gateway Kits 20 reactions N/A K59110, K591000
pENTR 5鈥?-TOPO TA Cloning Kit 20 reactions N/A K59120
COMPONENTS
(back to Table of Contents)
MultiSite Gateway Three- Fragment Vector Construction Kit (12537023):
Vectors (part number 440111)
Name Size Part Number Catalog Number
pDONRP4-P1R 6 ug 351291 NA
pDONRP2R-P3 6 ug 351289 NA
pDONR221 6 ug 351687 12536017
pDESTR4-R3 6 ug 351287 NA
pMS/GW control plasmid 10 ug 351299 NA
BP Clonase enzyme Mix (part number 11789013)
Name Size Part Number Catalog Number
BP Clonase Enzyme mix 80 ul 52883 11789013
5X BP Clonase Reaction Buffer 100 ul 59891 NA
Proteinase K solution 40 ul 59895 NA
30% PEG/Mg solution 1 ml 59890 NA
pEXP7-tet positive control 20 ul 53528 NA
LR Clonase Plus Enzyme Mix (part number
12538013)
Name Size Part Number Catalog Number
LR Clonase Plus Enzyme Mix 80 ul 52884 12538013
5X LR Clonase Plus Reaction Buffer 100 ul Y52886 NA
Proteinase K solution 40 ul 59895 NA
5
Competent E. coli (part number 440301)
Name Size Part Number Catalog Number
One Shot TOP10 chemically competent cells 21 x 50 ul 500257 NA
S.O.C. Medium 6 ml 460700 15544034
pUC19 control DNA 50 ul at 10 54357 15364011
pg/ul
pENTR5鈥?-TOPO TA Cloning Kit (K59120):
pENTR5鈥?-TOPO reagents (part number 450711)
Name Size Part Number Catalog Number
pENTR5鈥?-TOPO vector 20 ul 461020 NA
10X PCR Buffer 100 ul 460121 NA
50mM dNTP Mix 10 ul 460122 NA
Salt solution 50 ul 460205 NA
Sterile water 1 ml 460113 NA
GW1 Primer 20 ul 460698 NA
GW3 Primer 20 ul 461019 NA
Control PCR Primers 10 ul 460064 NA
Control PCR Template 10 ul 460071 NA
Competent E. coli (part number 440301)
Name Size Part Number Catalog Number
One Shot TOP10 chemically competent cells 21 x 50 ul 500257 NA
S.O.C. Medium 6 ml 460700 15544034
pUC19 control DNA 50 ul at 10 54357 15364011
pg/ul
ASSOCIATED PRODUCTS
(back to Table of Contents)
Product Amount Catalog Number
BP Clonase II Enzyme Mix 20 reactions 11789020
LR Clonase. Plus Enzyme Mix 20 reactions 12538013
One Shot TOP10 Chemically Competent E. coli 20 x 50 ul C404003
Library Efficiency DH5alpha Chemically Competent E. coli 5 x 0.2 ml 11782018
One Shot ccdB Survival T1R Chemically Competent 10 x 50 ul C751003
E. coli
pDONR221 6 ug 12536017
S.N.A.P. MidiPrep Kit 20 reactions K191001
PureLink HQ Mini Plasmid Purification Kit 100 reactions K210001
PureLink PCR Purification Kit 50 reactions K310001
Ampicillin 20 ml (10 mg/ml) 11593019
Kanamycin Sulfate 100 ml (10 mg/ml) 15160054
Platinum Taq DNA Polymerase 100 reactions 10966018
500 reactions 10966034
6
Platinum Taq DNA Polymerase High Fidelity 100 reactions 11304011
500 reactions 11304029
AccuPrime Pfx DNA Polymerase 200 rxns 12344024
1000 rxns 12344032
Need more help? Please email us by clicking here.
7
|